v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-30a URS0000361AEA_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUAAACAUCCUCGACUGGAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Callorhinchus milii (elephant shark) eshark_mir-30_3
  2. Canis lupus familiaris cfa-miR-30a
  3. Cricetulus griseus cgr-miR-30a-5p
  4. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-440
  5. Homo sapiens (human) microRNA miR-97
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-4271029
  7. Ornithorhynchus anatinus oan-miR-30a-5p
  8. Ovis aries oar-miR-30a-5p
  9. Petromyzon marinus pma-miR-30a-5p
  10. Pteropus alecto (black flying fox) pal-miR-30a-5p
  11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63019
  12. Taeniopygia guttata tgu-miR-30b-5p
  13. Xenopus laevis xla-miR-30a-5p
  14. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2301983