Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Petromyzon marinus (sea lamprey) pma-miR-30a-5p URS0000361AEA_7757

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUCGACUGGAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Callithrix jacchus cja-miR-30a
  2. Callorhinchus milii (elephant shark) eshark_mir-30_3
  3. Canis lupus familiaris cfa-miR-30a
  4. Cricetulus griseus cgr-miR-30a-5p
  5. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-440
  6. Homo sapiens (human) microRNA miR-97
  7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-4271029
  8. Ornithorhynchus anatinus oan-miR-30a-5p
  9. Ovis aries oar-miR-30a-5p
  10. Pteropus alecto (black flying fox) pal-miR-30a-5p
  11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63019
  12. Taeniopygia guttata tgu-miR-30b-5p
  13. Xenopus laevis xla-miR-30a-5p
  14. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2301983