Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-4271029 URS0000361AEA_10090

• 23 nucleotides
• 2 databases (ENA, PirBase)
• Found in 14 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. piRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGUAAACAUCCUCGACUGGAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

1. Callithrix jacchus cja-miR-30a
2. Callorhinchus milii (elephant shark) eshark_mir-30_3
3. Canis lupus familiaris cfa-miR-30a
4. Cricetulus griseus cgr-miR-30a-5p
5. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-440
6. Homo sapiens (human) microRNA miR-97
7. Ornithorhynchus anatinus oan-miR-30a-5p
8. Ovis aries oar-miR-30a-5p
9. Petromyzon marinus pma-miR-30a-5p
10. Pteropus alecto (black flying fox) pal-miR-30a-5p
11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63019
12. Taeniopygia guttata tgu-miR-30b-5p
13. Xenopus laevis xla-miR-30a-5p
14. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2301983

Download

• FASTA
• JSON