Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-204 URS000029D9F1_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-204: Ssc-mir-204 is one of the abundant miRNAs that have been studied in relation to differential expression between two breeds [PMC6718901]. In a study, the level of ssc-mir-204 did not show a significant change at 12 hours post-infection, but a marked reduction was observed in infected cells compared to uninfected cells from 24 hours onwards [PMC5412334]. This reduction in ssc-mir-204 levels was observed in response to SIV-H1N1/2009 infection [PMC5412334]. Additionally, another miRNA called ssc-miR-4331 also showed a similar pattern of reduction in response to the same infection [PMC5412334]. These findings suggest that ssc-mir-204 and ssc-miR-4331 may play a role in the response to SIV-H1N1/2009 infection. However, further research is needed to fully understand the specific functions and mechanisms of these miRNAs.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCCUUUGUCAUCCUAUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Alligator mississippiensis (American alligator) ami-miR-204-5p
  2. Anolis carolinensis aca-miR-204a-5p
  3. Bos taurus bta-miR-204
  4. Callithrix jacchus cja-miR-204
  5. Callorhinchus milii (elephant shark) Cmi-Mir-204-P1_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-204
  7. Capra hircus (goat) chi-miR-204-5p
  8. Cavia porcellus cpo-miR-204-5p
  9. Cervus elaphus cel-miR-204
  10. Chiloscyllium plagiosum microRNA cpl-miR-204
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-204-P1_5p (mature (guide))
  12. Chrysemys picta cpi-miR-204-5p
  13. Columba livia cli-miR-204-5p
  14. Cricetulus griseus cgr-miR-204
  15. Danio rerio (zebrafish) dre-miR-204-5p
  16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-204-5p
  17. Echinops telfairi Ete-Mir-204-P2_5p (mature (guide))
  18. Equus caballus eca-miR-204b
  19. Gadus morhua gmo-miR-204-5p
  20. Gallus gallus (chicken) gga-miR-204
  21. Gekko japonicus Gja-Mir-204-P1_5p (mature (guide))
  22. Gorilla gorilla gorilla ggo-miR-204 (MIR204)
  23. Gorilla gorilla ggo-miR-204
  24. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-204
  25. Homo sapiens (human) hsa-miR-204-5p
  26. Ictalurus punctatus (channel catfish) ipu-miR-204
  27. Latimeria chalumnae (coelacanth) Lch-Mir-204-P1_5p (mature (guide))
  28. Lepisosteus oculatus Loc-Mir-204-P1_5p (mature (guide))
  29. Macaca mulatta (Rhesus monkey) mml-miR-204-5p
  30. Macaca nemestrina (pig-tailed macaque) mne-miR-204
  31. Maylandia zebra mze-miR-204
  32. Microcaecilia unicolor Mun-Mir-204-P1_5p (mature (guide))
  33. Microcebus murinus mmr-miR-204
  34. Monodelphis domestica (gray short-tailed opossum) mdo-miR-204
  35. Monopterus albus (swamp eel) Mal-Mir-204-P1b_5p (mature (guide))
  36. Mus musculus mmu-miR-204-5p
  37. Neolamprologus brichardi (lyretail cichlid) nbr-miR-204
  38. Ophiophagus hannah (king cobra) oha-miR-204-5p
  39. Oreochromis niloticus (Nile tilapia) oni-miR-204a
  40. Ornithorhynchus anatinus (platypus) oan-miR-204-5p
  41. Oryctolagus cuniculus (rabbit) ocu-miR-204-5p
  42. Pan paniscus ppa-miR-204
  43. Pan troglodytes ptr-miR-204
  44. Petromyzon marinus pma-miR-204-5p
  45. Pongo pygmaeus (Bornean orangutan) ppy-miR-204
  46. Pteropus alecto pal-miR-204-5p
  47. Pundamilia nyererei pny-miR-204
  48. Python bivittatus Pbv-Mir-204-P1_5p (mature (guide))
  49. Rattus norvegicus rno-miR-204-5p
  50. Saguinus labiatus (red-chested mustached tamarin) sla-miR-204
  51. Salmo salar (Atlantic salmon) ssa-miR-204-5p
  52. Sarcophilus harrisii Sha-Mir-204-P1_5p (mature (guide))
  53. Scyliorhinus torazame (cloudy catshark) Sto-Mir-204-P2_5p (mature (guide))
  54. Sphenodon punctatus (tuatara) Spt-Mir-204-P2_5p (mature (guide))
  55. Taeniopygia guttata tgu-miR-204
  56. Takifugu rubripes (torafugu) fru-miR-204a
  57. Tetraodon nigroviridis tni-miR-204a
  58. Tor tambroides (Thai mahseer) miR-204-5p
  59. Xenopus laevis Xla-Mir-204-P1c_5p (mature (guide))
  60. Xenopus tropicalis xtr-miR-204
Publications