Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-204 URS000029D9F1_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-miR-204: gga-mir-204 is a highly conserved miRNA that is found to be almost three-fold more abundant in R+ animals compared to R- animals [PMC4256448]. It is also significantly upregulated in chicken under feed deprived conditions [PMC4256448]. gga-mir-204 has been shown to block insulin production by downregulating MAFA, an insulin transcription factor, in pancreatic beta-cells [PMC4256448]. It is one of the miRNAs that are differentially abundant between feeding conditions and also exhibits significant differential abundance for the Line contrast [PMC4256448]. The target genes of gga-mir-204 are involved in processes such as antigen processing and presentation, apoptosis, and chronic myeloid leukemia pathway [PMC4735322]. Additionally, gga-mir-204 has been found to be expressed in VVs and its expression levels have been measured using qRT-PCR [PMC10014936]. In a study comparing different miRNAs expressed in CD30hi lymphocytes, gga-mir-204 was found to be increased [PMC3472249]. In another study comparing LP and LCa groups, gga-mir-204 was upregulated in LP group and its target genes were enriched in various metabolic pathways [PMC8241840]. Furthermore, gga-mir-204 has been predicted to interact with EDN-3 using the stem-loop sequence of the miRNA [PMC5390260]. References: [PMC4256448]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4256448/ [PMC4735322]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4735322/ [PMC10014936]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10014936/ [PM3472249]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3472249/ [PMC8241840]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8241840/ [PMC5390260]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5390260/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCCUUUGUCAUCCUAUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Alligator mississippiensis (American alligator) ami-miR-204-5p
  2. Anolis carolinensis aca-miR-204a-5p
  3. Bos taurus bta-miR-204
  4. Callithrix jacchus cja-miR-204
  5. Callorhinchus milii (elephant shark) Cmi-Mir-204-P1_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-204
  7. Capra hircus (goat) chi-miR-204-5p
  8. Cavia porcellus cpo-miR-204-5p
  9. Cervus elaphus cel-miR-204
  10. Chiloscyllium plagiosum microRNA cpl-miR-204
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-204-P1_5p (mature (guide))
  12. Chrysemys picta cpi-miR-204-5p
  13. Columba livia cli-miR-204-5p
  14. Cricetulus griseus cgr-miR-204
  15. Danio rerio (zebrafish) dre-miR-204-5p
  16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-204-5p
  17. Echinops telfairi Ete-Mir-204-P2_5p (mature (guide))
  18. Equus caballus eca-miR-204b
  19. Gadus morhua gmo-miR-204-5p
  20. Gekko japonicus Gja-Mir-204-P1_5p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-204 (MIR204)
  22. Gorilla gorilla ggo-miR-204
  23. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-204
  24. Homo sapiens (human) hsa-miR-204-5p
  25. Ictalurus punctatus (channel catfish) ipu-miR-204
  26. Latimeria chalumnae (coelacanth) Lch-Mir-204-P1_5p (mature (guide))
  27. Lepisosteus oculatus Loc-Mir-204-P1_5p (mature (guide))
  28. Macaca mulatta (Rhesus monkey) mml-miR-204-5p
  29. Macaca nemestrina (pig-tailed macaque) mne-miR-204
  30. Maylandia zebra mze-miR-204
  31. Microcaecilia unicolor Mun-Mir-204-P1_5p (mature (guide))
  32. Microcebus murinus mmr-miR-204
  33. Monodelphis domestica (gray short-tailed opossum) mdo-miR-204
  34. Monopterus albus (swamp eel) Mal-Mir-204-P1b_5p (mature (guide))
  35. Mus musculus mmu-miR-204-5p
  36. Neolamprologus brichardi (lyretail cichlid) nbr-miR-204
  37. Ophiophagus hannah (king cobra) oha-miR-204-5p
  38. Oreochromis niloticus (Nile tilapia) oni-miR-204a
  39. Ornithorhynchus anatinus (platypus) oan-miR-204-5p
  40. Oryctolagus cuniculus (rabbit) ocu-miR-204-5p
  41. Pan paniscus ppa-miR-204
  42. Pan troglodytes ptr-miR-204
  43. Petromyzon marinus pma-miR-204-5p
  44. Pongo pygmaeus (Bornean orangutan) ppy-miR-204
  45. Pteropus alecto pal-miR-204-5p
  46. Pundamilia nyererei pny-miR-204
  47. Python bivittatus Pbv-Mir-204-P1_5p (mature (guide))
  48. Rattus norvegicus rno-miR-204-5p
  49. Saguinus labiatus (red-chested mustached tamarin) sla-miR-204
  50. Salmo salar (Atlantic salmon) ssa-miR-204-5p
  51. Sarcophilus harrisii Sha-Mir-204-P1_5p (mature (guide))
  52. Scyliorhinus torazame (cloudy catshark) Sto-Mir-204-P2_5p (mature (guide))
  53. Sphenodon punctatus (tuatara) Spt-Mir-204-P2_5p (mature (guide))
  54. Sus scrofa ssc-miR-204
  55. Taeniopygia guttata tgu-miR-204
  56. Takifugu rubripes (torafugu) fru-miR-204a
  57. Tetraodon nigroviridis tni-miR-204a
  58. Tor tambroides (Thai mahseer) miR-204-5p
  59. Xenopus laevis Xla-Mir-204-P1c_5p (mature (guide))
  60. Xenopus tropicalis xtr-miR-204
Publications