Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-204-5p URS000029D9F1_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-204: Mmu-mir-204 is a microRNA that was assessed for expression in mice using TaqMan RT-PCR assays [PMC4386824]. The expression of mmu-mir-204 was compared between wild-type and Pkd1-/- genotypes at different developmental stages [PMC3111376]. The reverse transcription primer and PCR primers for mmu-mir-204 were specified in a study [PMC6599052]. Mmu-mir-204 expression was found to be reduced in Sca-1+CD31− cells compared to Sca-1+CD31+ cells [PMC4889861]. Mmu-miR-142 was observed in the study, which is relevant to understanding the pathogenesis of Chlamydia [PMC6379932]. In a microarray experiment, mmu-mir-204 was downregulated in white adipose tissue (WAT) in response to high-fat diet (HFD) feeding [PMC4571067]. Mmu-mir-204 has been shown to promote adipogenesis and repress osteogenesis through Runx2 repression [PMC3319598]. Mmu-miR-133b and mmu-miR-204 target Runx2, which is involved in osteogenesis and adipogenesis regulation [PMC3319598]. The expression of mmu-mir-204, along with other microRNAs, was validated using qPCR analysis [PMC3319598]. Consistent with previous studies, the downregulation of mmu-miR-200 family and mmu-mir-204 were observed after HFD feeding [PMC3319598].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCCUUUGUCAUCCUAUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Alligator mississippiensis (American alligator) ami-miR-204-5p
  2. Anolis carolinensis aca-miR-204a-5p
  3. Bos taurus bta-miR-204
  4. Callithrix jacchus cja-miR-204
  5. Callorhinchus milii (elephant shark) Cmi-Mir-204-P1_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-204
  7. Capra hircus (goat) chi-miR-204-5p
  8. Cavia porcellus cpo-miR-204-5p
  9. Cervus elaphus cel-miR-204
  10. Chiloscyllium plagiosum microRNA cpl-miR-204
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-204-P1_5p (mature (guide))
  12. Chrysemys picta cpi-miR-204-5p
  13. Columba livia cli-miR-204-5p
  14. Cricetulus griseus cgr-miR-204
  15. Danio rerio (zebrafish) dre-miR-204-5p
  16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-204-5p
  17. Echinops telfairi Ete-Mir-204-P2_5p (mature (guide))
  18. Equus caballus eca-miR-204b
  19. Gadus morhua gmo-miR-204-5p
  20. Gallus gallus (chicken) gga-miR-204
  21. Gekko japonicus Gja-Mir-204-P1_5p (mature (guide))
  22. Gorilla gorilla gorilla ggo-miR-204 (MIR204)
  23. Gorilla gorilla ggo-miR-204
  24. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-204
  25. Homo sapiens (human) hsa-miR-204-5p
  26. Ictalurus punctatus (channel catfish) ipu-miR-204
  27. Latimeria chalumnae (coelacanth) Lch-Mir-204-P1_5p (mature (guide))
  28. Lepisosteus oculatus Loc-Mir-204-P1_5p (mature (guide))
  29. Macaca mulatta (Rhesus monkey) mml-miR-204-5p
  30. Macaca nemestrina (pig-tailed macaque) mne-miR-204
  31. Maylandia zebra mze-miR-204
  32. Microcaecilia unicolor Mun-Mir-204-P1_5p (mature (guide))
  33. Microcebus murinus mmr-miR-204
  34. Monodelphis domestica (gray short-tailed opossum) mdo-miR-204
  35. Monopterus albus (swamp eel) Mal-Mir-204-P1b_5p (mature (guide))
  36. Neolamprologus brichardi (lyretail cichlid) nbr-miR-204
  37. Ophiophagus hannah (king cobra) oha-miR-204-5p
  38. Oreochromis niloticus (Nile tilapia) oni-miR-204a
  39. Ornithorhynchus anatinus (platypus) oan-miR-204-5p
  40. Oryctolagus cuniculus (rabbit) ocu-miR-204-5p
  41. Pan paniscus ppa-miR-204
  42. Pan troglodytes ptr-miR-204
  43. Petromyzon marinus pma-miR-204-5p
  44. Pongo pygmaeus (Bornean orangutan) ppy-miR-204
  45. Pteropus alecto pal-miR-204-5p
  46. Pundamilia nyererei pny-miR-204
  47. Python bivittatus Pbv-Mir-204-P1_5p (mature (guide))
  48. Rattus norvegicus rno-miR-204-5p
  49. Saguinus labiatus (red-chested mustached tamarin) sla-miR-204
  50. Salmo salar (Atlantic salmon) ssa-miR-204-5p
  51. Sarcophilus harrisii Sha-Mir-204-P1_5p (mature (guide))
  52. Scyliorhinus torazame (cloudy catshark) Sto-Mir-204-P2_5p (mature (guide))
  53. Sphenodon punctatus (tuatara) Spt-Mir-204-P2_5p (mature (guide))
  54. Sus scrofa ssc-miR-204
  55. Taeniopygia guttata tgu-miR-204
  56. Takifugu rubripes (torafugu) fru-miR-204a
  57. Tetraodon nigroviridis tni-miR-204a
  58. Tor tambroides (Thai mahseer) miR-204-5p
  59. Xenopus laevis Xla-Mir-204-P1c_5p (mature (guide))
  60. Xenopus tropicalis xtr-miR-204
Publications