Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-let-7i-p3 URS0000237CBD_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCGCAAGCUACUGCCUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Alligator mississippiensis (American alligator) ami-let-7i-3p
  2. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-let-7i
  3. Capra hircus chi-let-7i-3p
  4. Cavia porcellus cpo-let-7i-3p
  5. Chrysemys picta cpi-let-7i-3p
  6. Columba livia (rock pigeon) cli-let-7i-3p
  7. Dasypus novemcinctus dno-let-7i-3p
  8. Homo sapiens hsa-let-7i-3p
  9. Mus musculus (house mouse) mmu-let-7i-3p
  10. Oryctolagus cuniculus ocu-let-7i-3p
  11. Python bivittatus (Burmese python) pbv-let-7i-3p
  12. Rattus norvegicus rno-let-7i-3p
  13. Sus scrofa (pig) ssc-let-7i-3p
  14. Taeniopygia guttata (zebra finch) tgu-let-7i-3p