v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-let-7i-3p URS0000237CBD_59729

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGCGCAAGCUACUGCCUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Alligator mississippiensis (American alligator) ami-let-7i-3p
  2. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-let-7i
  3. Capra hircus (goat) chi-let-7i-3p
  4. Cavia porcellus (domestic guinea pig) cpo-let-7i-3p
  5. Cervus elaphus cel-let-7i-p3
  6. Chrysemys picta (Painted turtle) cpi-let-7i-3p
  7. Columba livia (rock pigeon) cli-let-7i-3p
  8. Dasypus novemcinctus dno-let-7i-3p
  9. Homo sapiens hsa-let-7i-3p
  10. Mus musculus mmu-let-7i-3p
  11. Oryctolagus cuniculus ocu-let-7i-3p
  12. Python bivittatus pbv-let-7i-3p
  13. Rattus norvegicus (Norway rat) rno-let-7i-3p
  14. Sus scrofa ssc-let-7i-3p
 Relationships

Molecular Relationships

 Publications