Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7i-3p URS0000237CBD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-let-7i: Hsa-let-7i is a type of human miRNA that has been found to be down-regulated in blood cells of lung cancer patients, along with hsa-let-7a, hsa-let-7d, hsa-let-7f, and hsa-let-7g [PMC2764731]. Additionally, a study has shown that hsa-miR-mit-2 has three matches with let-7 human miRNA, including hsa-let-7i [PMC4324738]. These findings suggest that there may be a relationship between the down-regulation of let-7 miRNAs and lung cancer [PMC2764731][PMC4324738]. The down-regulation of let-7 miRNAs in lung cancer patients' blood cells may have implications for the development and progression of the disease [PMC2764731]. Further research is needed to fully understand the role of let-7i and other let-miRNAs in lung cancer [PMC2764731][PMC4324738]. Understanding the mechanisms by which these miRNAs are down-regulated could potentially lead to the development of new diagnostic or therapeutic approaches for lung cancer patients [PMC2764731].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCGCAAGCUACUGCCUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Alligator mississippiensis (American alligator) ami-let-7i-3p
  2. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-let-7i
  3. Capra hircus chi-let-7i-3p
  4. Cavia porcellus cpo-let-7i-3p
  5. Cervus elaphus cel-let-7i-p3
  6. Chrysemys picta cpi-let-7i-3p
  7. Columba livia (rock pigeon) cli-let-7i-3p
  8. Dasypus novemcinctus dno-let-7i-3p
  9. Mus musculus (house mouse) mmu-let-7i-3p
  10. Oryctolagus cuniculus ocu-let-7i-3p
  11. Python bivittatus (Burmese python) pbv-let-7i-3p
  12. Rattus norvegicus rno-let-7i-3p
  13. Sus scrofa (pig) ssc-let-7i-3p
  14. Taeniopygia guttata (zebra finch) tgu-let-7i-3p
Publications