Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-let-7i-3p URS0000237CBD_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-let-7i: Ssc-let-7i is a type of microRNA that is abundantly expressed in Laiwu pigs compared to Large White pigs [PMC9859024]. It is one of the differentially expressed miRNAs responsible for regulating subcutaneous adipogenic differentiation [PMC9859024]. In a study comparing PRRSV-infected and mock-infected PAMs, the let-7 family, including ssc-let-7i, was found to be significantly differentially expressed [PMC9550049]. Ssc-let-7i is a 21 nt sequence that lacks three nucleotides (GUU) at the 3' end according to miRBase [PMC4400304]. However, there is some dispute regarding the exact sequence of ssc-let-7i, with some studies suggesting it may be 22 nt in length [PMC4400304]. Ssc-let-7i was found to be one of the most abundant miRNAs in porcine testes and was consistently expressed in all six libraries studied [PMC4400304] [PMC6354428]. In Landraces' lungs, ssc-let-7i was one of six DEmiRNAs that had a high expression value at 0 dpi but were significantly down-regulated at later time points [PMC5381705]. References: [PMC9859024] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9859024/ [PMC9550049] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9550049/ [PMC4400304] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4400304/ [PM6354428] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM6354428/ [PM5381705] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM5381705/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCGCAAGCUACUGCCUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Alligator mississippiensis (American alligator) ami-let-7i-3p
  2. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-let-7i
  3. Capra hircus chi-let-7i-3p
  4. Cavia porcellus cpo-let-7i-3p
  5. Cervus elaphus cel-let-7i-p3
  6. Chrysemys picta cpi-let-7i-3p
  7. Columba livia (rock pigeon) cli-let-7i-3p
  8. Dasypus novemcinctus dno-let-7i-3p
  9. Homo sapiens hsa-let-7i-3p
  10. Mus musculus (house mouse) mmu-let-7i-3p
  11. Oryctolagus cuniculus ocu-let-7i-3p
  12. Python bivittatus (Burmese python) pbv-let-7i-3p
  13. Rattus norvegicus rno-let-7i-3p
  14. Taeniopygia guttata (zebra finch) tgu-let-7i-3p
Publications