Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-let-7i-3p URS0000237CBD_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-let-7i: mmu-let-7i is a member of the well-documented let-7 family of microRNAs in T cells, which plays a role in various biological processes, including liver regeneration and the response to obesity [PMC4571067; PMC9198802]. It is associated with mmu-let-7b and mmu-let-7g after hierarchical clustering, but there is no direct evidence of it being grouped with mmu-miR-155 in this context [PMC4099493; PMC3937077]. The gene Acads, involved in fatty acid metabolism, is a putative target of mmu-let-7i [PMC3692539]. In the context of liver regeneration, upregulation of let-7 family members including mmu-let-7i has been observed [PMC9198802]. Additionally, dysregulation of five let-7 family members including mmu-let-7i has been linked to obesity and weight reduction following low-fat diet feeding [PMC4571067]. The expression levels of mmu-let-7i can be quantified using TaqMan® miRNA assays [PMC4077261]. Wild-type and mutated versions of mmu-let-7i are available commercially for research purposes [PMC4238354].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCGCAAGCUACUGCCUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Alligator mississippiensis (American alligator) ami-let-7i-3p
  2. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-let-7i
  3. Capra hircus (goat) chi-let-7i-3p
  4. Cavia porcellus (domestic guinea pig) cpo-let-7i-3p
  5. Cervus elaphus cel-let-7i-p3
  6. Chrysemys picta (Painted turtle) cpi-let-7i-3p
  7. Columba livia (rock pigeon) cli-let-7i-3p
  8. Dasypus novemcinctus dno-let-7i-3p
  9. Homo sapiens hsa-let-7i-3p
  10. Oryctolagus cuniculus ocu-let-7i-3p
  11. Python bivittatus pbv-let-7i-3p
  12. Rattus norvegicus (Norway rat) rno-let-7i-3p
  13. Sus scrofa ssc-let-7i-3p
  14. Taeniopygia guttata tgu-let-7i-3p
Relationships

Molecular Relationships

Publications