Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-130a-5p URS0000229ECD_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-130a: Rno-mir-130a is a microRNA that has been studied in various contexts. In a study comparing qPCR and deep-sequencing results, the expression pattern of rno-mir-130a showed a minor discrepancy between the two methods at P0 [PMC3441217]. Another study detected the presence of primary and mature rno-mir-130a in rat cerebral cortices at both embryonic and postnatal stages [PMC4930766]. In healthy Wistar islets, rno-mir-130a, along with rno-miR-132, rno-miR-212, and rno-miR-335, responded to glucose stimulation [PMC3072418]. When comparing stimulation at 16.7G to 2.8G in Wistar islets, the expression levels of rno-mir-130a decreased [PMC3072418]. However, at 16.7G, the expression levels of rno-miR-212, rno-miR-132, and rno-mir-130a in GK (Goto-Kakizaki) islets coincided with those in Wistar islets [PMC3072418]. Furthermore, changes in miRNA expression were observed within a short temporal window of one hour for miRNAs such as rno-mir-130a [PMC3072418]. The TaqMan MicroRNA assay was used to assess microRNA levels for various miRNAs including rno-mir-130a [PMC3864878]. Overall, these studies provide insights into the expression patterns and responses of miRNAs such as rno-mir-130a in different contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCUUUUCACAUUGUGCUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Capra hircus chi-miR-130a-5p
  2. Cavia porcellus cpo-miR-130a-5p
  3. Chrysemys picta cpi-miR-130a-5p
  4. Cricetulus griseus cgr-miR-130a-5p
  5. Dasypus novemcinctus dno-miR-130a-5p
  6. Homo sapiens hsa-miR-130a-5p
  7. Macaca mulatta mml-miR-130a-5p
  8. Monodelphis domestica (gray short-tailed opossum) mdo-miR-130a-5p
  9. Mus musculus (house mouse) mmu-miR-130a-5p
  10. Ophiophagus hannah oha-miR-130c-5p
  11. Oryctolagus cuniculus ocu-miR-130a-5p
Publications