Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-130a-5p URS0000229ECD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-130a: Hsa-mir-130a is one of the miRNAs that may regulate TNF-α expression, according to a study that used a cut-off criterion to identify potential regulators [PMC7675078]. This study identified a total of 13 miRNAs that may regulate TNF-α expression, including hsa-mir-130a, hsa-miR-599, hsa-miR-130b, hsa-miR-454, hsa-miR-301a, hsa-miR-301b, hsa-miR-19b, hsa-miR-19a, hsa-miR-181a, hsa-miR-181b, hsa-miR-181c, and hsa-miR 181d [PMC7675078]. Additionally, the study identified two miRNAs that may regulate TNFR1 and TNFR2: HSA-MIR 335 and HSA-MIR 495 [PMC7675078]. Another analysis incorporated a 3 miRNA model consisting of HSA-MIR 193a , HSA-MIR 21 , and HSA-MIR 130a signature. This model showed a decreasing AUC to 0.84 ±0.021 [PMC9700700]. Overall these findings suggest that HSA-MIR130A is one of the potential regulators of TNF-alpha expression and could be part of a multi-gene signature for predicting disease outcomes or therapeutic responses related to TNF-alpha signaling pathways [PMC7675078] [PMC9700700].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCUUUUCACAUUGUGCUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Capra hircus chi-miR-130a-5p
  2. Cavia porcellus cpo-miR-130a-5p
  3. Chrysemys picta cpi-miR-130a-5p
  4. Cricetulus griseus cgr-miR-130a-5p
  5. Dasypus novemcinctus dno-miR-130a-5p
  6. Macaca mulatta mml-miR-130a-5p
  7. Monodelphis domestica (gray short-tailed opossum) mdo-miR-130a-5p
  8. Mus musculus (house mouse) mmu-miR-130a-5p
  9. Ophiophagus hannah oha-miR-130c-5p
  10. Oryctolagus cuniculus ocu-miR-130a-5p
  11. Rattus norvegicus rno-miR-130a-5p
Publications