Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chrysemys picta (Painted turtle) cpi-miR-130a-5p URS0000229ECD_8479

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCUUUUCACAUUGUGCUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Capra hircus chi-miR-130a-5p
  2. Cavia porcellus cpo-miR-130a-5p
  3. Cricetulus griseus cgr-miR-130a-5p
  4. Dasypus novemcinctus dno-miR-130a-5p
  5. Homo sapiens hsa-miR-130a-5p
  6. Macaca mulatta mml-miR-130a-5p
  7. Monodelphis domestica (gray short-tailed opossum) mdo-miR-130a-5p
  8. Mus musculus (house mouse) mmu-miR-130a-5p
  9. Ophiophagus hannah oha-miR-130c-5p
  10. Oryctolagus cuniculus ocu-miR-130a-5p
  11. Rattus norvegicus rno-miR-130a-5p