Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-130a-5p URS0000229ECD_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-130a: Mmu-mir-130a is a murine microRNA that was selected for qPCR validation of its expression, and it was found to be down-regulated in white adipose tissue (WAT) after high-fat diet (HFD) feeding [PMC3319598]. Mmu-mir-130a is known to be a pro-angiogenic miRNA, but its role in adipose tissue has not been described before [PMC3319598]. Additionally, the down-regulation of mmu-mir-130a during HFD-induced obesity has not been previously reported [PMC3319598]. Mmu-mir-130a has also been shown to enhance the activation of hepatic stellate cells (HSCs) by suppressing the expression of peroxisome proliferator-activated receptor γ [PMC6423634]. In response to HFD feeding, mmu-mir-130a was found to be downregulated in WAT, along with several other miRNAs [PMC4571067]. The genomic DNA sequence upstream of mmu-mir-130a showed 56.2% identity with the genomic DNA sequence upstream of ssc-miR-130a from Sus scrofa [PMC5776175]. Mmu-miR-29a, mmu-miR-126, mmu-mir-130a, mmu-miR-155, and mmu-miR125a/b were found to control the differentiation of HSCs by targeting different genes [PMC6829453]. In mice lacking mmu-mir-130a (mmu mir 130 KO mice), hepatic exosomes from transgenic mice overexpressing mmu mir 130 improved glucose intolerance and decreased insulin resistance when administered to KO mice. Additionally, KO mice gained significantly more weight on a HFD compared to wild-type mice. The release of hepatically expressed mmu-mir-130a in exosomes can regulate lipid and glucose metabolism in adipose tissue [PMC7936154].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCUUUUCACAUUGUGCUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Capra hircus chi-miR-130a-5p
  2. Cavia porcellus cpo-miR-130a-5p
  3. Chrysemys picta cpi-miR-130a-5p
  4. Cricetulus griseus cgr-miR-130a-5p
  5. Dasypus novemcinctus dno-miR-130a-5p
  6. Homo sapiens hsa-miR-130a-5p
  7. Macaca mulatta mml-miR-130a-5p
  8. Monodelphis domestica (gray short-tailed opossum) mdo-miR-130a-5p
  9. Ophiophagus hannah oha-miR-130c-5p
  10. Oryctolagus cuniculus ocu-miR-130a-5p
  11. Rattus norvegicus rno-miR-130a-5p
Publications