Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Medicago truncatula (barrel medic) mtr-miR156i-5p URS000020F5A7_3880

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mtr-miR156b-5p: mtr-mir156b-5p is a microRNA that exhibits opposite expression profiles during certain conditions [PMC8369265]. In a study, it was found that miR156a/b, including gma-miR156a and mtr-mir156b-5p, targeted SBP14 and up-regulated its expression under salt stress, suggesting that the miR156a/b-SBP14 module enhances salt tolerance by increasing ROS scavenging [PMC9011107]. Additionally, ginseng targets genes in the plant hormone signal transduction pathway through ptc-miR156k_L+1, mtr-mir156b-5p, gma-miR156a_R+1, and mtr-miR156e, leading to the inhibition of gene expression in the hormone synthesis pathway [PMC9659575]. Through a joint analysis with mRNA sequencing data, it was found that TRINITY_DN14567_c0_g4 is the target gene of ptc-miR156k_L+1, mtr-mir156b-5p, gma-miR156a_R+1, and mtr-miR156e in the plant hormone signal transduction pathway [PMC9659575]. Furthermore, all four miRNAs were negatively correlated with mRNA expression levels, suggesting their involvement in regulating disorders related to continuous cropping of ginseng and the synthesis of ginsenosides [PMC9659575].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACAGAAGAGAGUGAGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Aegilops tauschii ata-miR156d-5p
  2. Amborella trichopoda atr-miR156b
  3. Ananas comosus (pineapple) microRNA 156i
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR156a-5p
  5. Arabidopsis thaliana (thale cress) ath-miR156b-5p
  6. Asparagus officinalis (garden asparagus) aof-miR156a
  7. Brachypodium distachyon bdi-miR156h-5p
  8. Brassica napus bna-miR156e
  9. Brassica rapa bra-miR156c-5p
  10. Camelina sativa cas-miR156c-5p
  11. Carica papaya cpa-miR156b
  12. Citrus sinensis csi-miR156c-5p
  13. Citrus trifoliata (trifoliate orange) ctr-miR156
  14. Cucumis melo cme-miR156i
  15. Cynara cardunculus (wild artichoke) cca-miR156a
  16. Digitalis purpurea dpr-miR156b
  17. Eucalyptus globulus MICRORNA156.5
  18. Fragaria vesca subsp. vesca fve-miR156d
  19. Glycine max (soybean) gma-miR156w
  20. Gossypium hirsutum (cotton) ghr-miR156a
  21. Helianthus annuus (common sunflower) han-miR156a
  22. Helianthus argophyllus har-miR156a
  23. Helianthus tuberosus (Jerusalem artichoke) htu-miR156a
  24. Linum usitatissimum lus-miR156a
  25. Malus domestica mdm-miR156k
  26. Manihot esculenta (cassava) mes-miR156f
  27. Nicotiana tabacum (common tobacco) nta-miR156b
  28. Ophiorrhiza prostrata miRNA-156a
  29. Oryza sativa (Asian cultivated rice) osa-miR156b-5p
  30. Oryza sativa Japonica Group microRNA osa-miR156b-5p
  31. Physcomitrium patens ppt-miR156b
  32. Picea abies (Norway spruce) pab-miR156a
  33. Populus tomentosa Pto-miR156b
  34. Populus trichocarpa ptc-miR156e
  35. Prunus persica ppe-miR156d
  36. Rauvolfia tetraphylla miRNA-156a
  37. Rosa chinensis ath-miR156a-5p
  38. Saccharum officinarum (sugarcane) sof-miR156
  39. Solanum lycopersicum sly-miR156d-5p
  40. Solanum tuberosum stu-miR156h-5p
  41. Sorghum bicolor (sorghum) sbi-miR156h
  42. Theobroma cacao (cacao) tcc-miR156g
  43. Tinospora cordifolia miRNA-156a
  44. Triticum aestivum tae-csmR156-1
  45. Vigna unguiculata vun-miR156a
  46. Vitis vinifera (wine grape) vvi-miR156b
  47. Vriesea carinata vca-miR156a-5p
  48. Zea mays (maize) zma-miR156b-5p
Publications