Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Solanum lycopersicum (tomato) sly-miR156d-5p URS000020F5A7_4081

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

sly-miR156d-5p: sly-mir156d-5p is an up-regulated microRNA (miRNA) that was identified and shown to be expressed differently in stem and callus tissue [PMC7745965]. It is predicted to target the promoter binding protein (SBP) domain SQUAMOSA [PMC7745965]. Additionally, sly-mir156d-5p targets the same genes as sly-miR156e-5p and sly-miR156a, including solyc05g015840.2, solyc12g038520.1, solyc10g078700.1, solyc05g015510.2, solyc05g012040.2, and solyc04g045560.2 [PMC7745965]. Another target of sly-mir156d-5p is the lncRNA Lnc_000257 [PMC9295719]. In S. pennellii, sly-mir156d-5p targets Lnc_000990 [PMC9295719]. On the other hand, sly-miR156e-5p is a down-regulated miRNA that was also identified in stem and callus tissue [PMC7745965]. It is predicted to target the SBP domain SQUAMOSA as well [PMC7745965]. Additionally, it targets the same genes as sly-mir156d-5p and sly-miR156a in tomato [PMC7745965]. In terms of lncRNAs targeted by sly-miR156e-5p in tomato (Solanum lycopersicum), Lnc_000257 and Lnc_000976 are targeted by this miRNA [PMC9295719]. In S. pennellii (wild tomato), both sly-mir156d-5p and sly-miR395a target two lncRNAs: Lnc_000990 for mirS.lyr-MIR156d and Lnc_000976 for mirS.lyr-MIR156e [PMC9295719]. Additionally, sly-miR5302a and sly-miR6022 also target these two lncRNAs [PMC9295719]. Overall, sly-mir156d-5p and sly-miR156e-5p are differentially expressed miRNAs in tomato, with distinct target genes and lncRNAs in both tomato and S. pennellii [PMC7745965][PMC9295719].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACAGAAGAGAGUGAGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Aegilops tauschii ata-miR156d-5p
  2. Amborella trichopoda atr-miR156b
  3. Ananas comosus (pineapple) microRNA 156i
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR156a-5p
  5. Arabidopsis thaliana (thale cress) ath-miR156b-5p
  6. Asparagus officinalis (garden asparagus) aof-miR156a
  7. Brachypodium distachyon bdi-miR156h-5p
  8. Brassica napus bna-miR156e
  9. Brassica rapa bra-miR156c-5p
  10. Camelina sativa cas-miR156c-5p
  11. Carica papaya cpa-miR156b
  12. Citrus sinensis csi-miR156c-5p
  13. Citrus trifoliata (trifoliate orange) ctr-miR156
  14. Cucumis melo cme-miR156i
  15. Cynara cardunculus (wild artichoke) cca-miR156a
  16. Digitalis purpurea dpr-miR156b
  17. Eucalyptus globulus MICRORNA156.5
  18. Fragaria vesca subsp. vesca fve-miR156d
  19. Glycine max (soybean) gma-miR156w
  20. Gossypium hirsutum (cotton) ghr-miR156a
  21. Helianthus annuus (common sunflower) han-miR156a
  22. Helianthus argophyllus har-miR156a
  23. Helianthus tuberosus (Jerusalem artichoke) htu-miR156a
  24. Linum usitatissimum lus-miR156a
  25. Malus domestica mdm-miR156k
  26. Manihot esculenta (cassava) mes-miR156f
  27. Medicago truncatula (barrel medic) mtr-miR156i-5p
  28. Nicotiana tabacum (common tobacco) nta-miR156b
  29. Ophiorrhiza prostrata miRNA-156a
  30. Oryza sativa (Asian cultivated rice) osa-miR156b-5p
  31. Oryza sativa Japonica Group microRNA osa-miR156b-5p
  32. Physcomitrium patens ppt-miR156b
  33. Picea abies (Norway spruce) pab-miR156a
  34. Populus tomentosa Pto-miR156b
  35. Populus trichocarpa ptc-miR156e
  36. Prunus persica ppe-miR156d
  37. Rauvolfia tetraphylla miRNA-156a
  38. Rosa chinensis ath-miR156a-5p
  39. Saccharum officinarum (sugarcane) sof-miR156
  40. Solanum tuberosum stu-miR156h-5p
  41. Sorghum bicolor (sorghum) sbi-miR156h
  42. Theobroma cacao (cacao) tcc-miR156g
  43. Tinospora cordifolia miRNA-156a
  44. Triticum aestivum tae-csmR156-1
  45. Vigna unguiculata vun-miR156a
  46. Vitis vinifera (wine grape) vvi-miR156b
  47. Vriesea carinata vca-miR156a-5p
  48. Zea mays (maize) zma-miR156b-5p
Publications