Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brassica rapa (field mustard) bra-miR156c-5p URS000020F5A7_3711

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bra-miR156a-5p: Bra-mir156a-5p is a type of bra-miR156 miRNA [PMC10043383]. It is involved in the regulation of the BraA06g043820.3C gene, which is upregulated in 'pet' [PMC10039531]. Bra-mir156a-5p, along with other miRNAs such as bra-miR319-3p, bra-miR391-3p, and vvi-miR172d_L-2R + 1, is present in ceRNA networks [PMC10039531]. It regulates several genes including BraA02g000170.3C, BraA04g028240.3C, BraA06g010130.3C, BraA06g043820.3C, BraA07g025310.3C, BraA07g028930.3C and BraA09g058330.3C [PMC10039531]. In a constructed network, bra-mir156a-5p functions as a regulator of genes involved in pathways such as sugar metabolism and lipid metabolism [PMC6801457]. It has been studied in PDA cell lines BxPc-3 and Bx-Gem where it was lipofected along with other miRNAs for experimental evaluation [PMC7147085]. In another study involving broccoletti-miRs and apoptosis-related genes, bra-mir156a-5p was found to be one of the most corresponding broccoletti-miRs to the selected genes [PMC7147085]. Dysregulation of bra-mir156a-5p has been correlated with adherens junctions and migration [PMC7147085]. It has also been found to co-target BrLYP2 transcript along with other miRNAs such as bra-mir5721 and bra-mir9565-3p [PMC8750388]. Additionally, bra-mir156a-5p is regulated by eTMs and is differentially expressed in Chinese cabbage under heat stress [PMC6428831].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACAGAAGAGAGUGAGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Aegilops tauschii ata-miR156d-5p
  2. Amborella trichopoda atr-miR156b
  3. Ananas comosus (pineapple) microRNA 156i
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR156a-5p
  5. Arabidopsis thaliana (thale cress) ath-miR156b-5p
  6. Asparagus officinalis (garden asparagus) aof-miR156a
  7. Brachypodium distachyon bdi-miR156h-5p
  8. Brassica napus bna-miR156e
  9. Camelina sativa cas-miR156c-5p
  10. Carica papaya cpa-miR156b
  11. Citrus sinensis csi-miR156c-5p
  12. Citrus trifoliata (trifoliate orange) ctr-miR156
  13. Cucumis melo cme-miR156i
  14. Cynara cardunculus (wild artichoke) cca-miR156a
  15. Digitalis purpurea dpr-miR156b
  16. Eucalyptus globulus MICRORNA156.5
  17. Fragaria vesca subsp. vesca fve-miR156d
  18. Glycine max (soybean) gma-miR156w
  19. Gossypium hirsutum (cotton) ghr-miR156a
  20. Helianthus annuus (common sunflower) han-miR156a
  21. Helianthus argophyllus har-miR156a
  22. Helianthus tuberosus (Jerusalem artichoke) htu-miR156a
  23. Linum usitatissimum lus-miR156a
  24. Malus domestica mdm-miR156k
  25. Manihot esculenta (cassava) mes-miR156f
  26. Medicago truncatula (barrel medic) mtr-miR156i-5p
  27. Nicotiana tabacum (common tobacco) nta-miR156b
  28. Ophiorrhiza prostrata miRNA-156a
  29. Oryza sativa (Asian cultivated rice) osa-miR156b-5p
  30. Oryza sativa Japonica Group microRNA osa-miR156b-5p
  31. Physcomitrium patens ppt-miR156b
  32. Picea abies (Norway spruce) pab-miR156a
  33. Populus tomentosa Pto-miR156b
  34. Populus trichocarpa ptc-miR156e
  35. Prunus persica ppe-miR156d
  36. Rauvolfia tetraphylla miRNA-156a
  37. Rosa chinensis ath-miR156a-5p
  38. Saccharum officinarum (sugarcane) sof-miR156
  39. Solanum lycopersicum sly-miR156d-5p
  40. Solanum tuberosum stu-miR156h-5p
  41. Sorghum bicolor (sorghum) sbi-miR156h
  42. Theobroma cacao (cacao) tcc-miR156g
  43. Tinospora cordifolia miRNA-156a
  44. Triticum aestivum tae-csmR156-1
  45. Vigna unguiculata vun-miR156a
  46. Vitis vinifera (wine grape) vvi-miR156b
  47. Vriesea carinata vca-miR156a-5p
  48. Zea mays (maize) zma-miR156b-5p
Publications