Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis thaliana (thale cress) ath-miR156b-5p URS000020F5A7_3702

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ath-miR156a-5p: Ath-mir156a-5p is a microRNA that is significantly upregulated [PMC8511966]. PlantCircNet provided an integrated circRNA-miRNA-mRNA network that includes circRNAs and mRNAs targeted by ath-mir156a-5p [PMC5727401]. The expression levels of the targets of ath-mir156a-5p, as well as two sub-members of ath-miR157a-5p and ath-miR5654-5p, were higher in the CMS line compared to the MF line [PMC7392268]. Ath-mir156a-5p targets SBPs, while two sub-members of ath-miR157a-5p also target SBPs, and ath-miR5654-5p targets a PPR-containing protein [PMC7392268]. Ath-mir156a-5p and novel_80 were found to have a greater degree in down-regulated miRNAs and up-regulated mRNAs [PMC8080638]. Ath-mir156a-5p, novel_80, and other miRNAs were hypothesized to play essential roles in GRS formation [PMC8080638]. Several miRNAs including ath-mir156a-5p were found to have high degrees in the constructed interaction networks [PMC8080638]. The expression levels of ath-mir156a-5p, along with other miRNAs (ath-mir162a-3p and athmiR396a - 3 p), were analyzed using qPCR with TaqMan assays [PMC8991712]. Co-regulatory sRNAs were found for the regulatory pair "athmir 1 56 a - 3 p - AT1G27360.4" in all tissues except the root. The levels of AGO1 proteins were higher than that of ath-mir156a-5p [PMC7769420].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACAGAAGAGAGUGAGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Aegilops tauschii ata-miR156d-5p
  2. Amborella trichopoda atr-miR156b
  3. Ananas comosus (pineapple) microRNA 156i
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR156a-5p
  5. Asparagus officinalis (garden asparagus) aof-miR156a
  6. Brachypodium distachyon bdi-miR156h-5p
  7. Brassica napus bna-miR156e
  8. Brassica rapa bra-miR156c-5p
  9. Camelina sativa cas-miR156c-5p
  10. Carica papaya cpa-miR156b
  11. Citrus sinensis csi-miR156c-5p
  12. Citrus trifoliata (trifoliate orange) ctr-miR156
  13. Cucumis melo cme-miR156i
  14. Cynara cardunculus (wild artichoke) cca-miR156a
  15. Digitalis purpurea dpr-miR156b
  16. Eucalyptus globulus MICRORNA156.5
  17. Fragaria vesca subsp. vesca fve-miR156d
  18. Glycine max (soybean) gma-miR156w
  19. Gossypium hirsutum (cotton) ghr-miR156a
  20. Helianthus annuus (common sunflower) han-miR156a
  21. Helianthus argophyllus har-miR156a
  22. Helianthus tuberosus (Jerusalem artichoke) htu-miR156a
  23. Linum usitatissimum lus-miR156a
  24. Malus domestica mdm-miR156k
  25. Manihot esculenta (cassava) mes-miR156f
  26. Medicago truncatula (barrel medic) mtr-miR156i-5p
  27. Nicotiana tabacum (common tobacco) nta-miR156b
  28. Ophiorrhiza prostrata miRNA-156a
  29. Oryza sativa (Asian cultivated rice) osa-miR156b-5p
  30. Oryza sativa Japonica Group microRNA osa-miR156b-5p
  31. Physcomitrium patens ppt-miR156b
  32. Picea abies (Norway spruce) pab-miR156a
  33. Populus tomentosa Pto-miR156b
  34. Populus trichocarpa ptc-miR156e
  35. Prunus persica ppe-miR156d
  36. Rauvolfia tetraphylla miRNA-156a
  37. Rosa chinensis ath-miR156a-5p
  38. Saccharum officinarum (sugarcane) sof-miR156
  39. Solanum lycopersicum sly-miR156d-5p
  40. Solanum tuberosum stu-miR156h-5p
  41. Sorghum bicolor (sorghum) sbi-miR156h
  42. Theobroma cacao (cacao) tcc-miR156g
  43. Tinospora cordifolia miRNA-156a
  44. Triticum aestivum tae-csmR156-1
  45. Vigna unguiculata vun-miR156a
  46. Vitis vinifera (wine grape) vvi-miR156b
  47. Vriesea carinata vca-miR156a-5p
  48. Zea mays (maize) zma-miR156b-5p
Publications