Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-381-3p URS00001FFA8C_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-381: Mmu-mir-381 is a microRNA that has been studied in various contexts. It has been found that the edited form of mmu-mir-381 shares the same seed sequence as mmu-miR-300, although the rest of the sequence differs between the two miRNAs [PMC3409261]. In a study on Ews/Ewsr1 KO mice, it was observed that mmu-mir-381, along with mmu-miR-181a/b/c, was up-regulated in the spinal cord [PMC4989891]. The up-regulation of these miRNAs was associated with the down-regulation of G protein complex in the spinal cord of Ews/Ewsr1 KO mice [PMC4989891]. In another study, it was found that mmu-mir-381 was one of 15 up-regulated miRNAs in a specific order of significance score by SAM [PMC4989891]. Mmu-mir-381 and mmu-miR-181a/b/c were found to suppress Gnai1 and were inhibited by Rgs1 and Rgs19 in the spinal cord of Ews/Ewsr1 KO mice [PMC4989891]. The miRBase accession number for mmu-mir-381 is MI0000798 [PMC3669147]. Additionally, during brown adipocyte differentiation, mmu-mir-381 showed a trend for stronger upregulation along with other miRNAs such as miRPlus_17856 and mmu-miR-501-3p [PMC3070678]. Overall, these studies highlight various aspects and roles of mmu-mir-381 in different biological contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUACAAGGGCAAGCUCUCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus bta-miR-381
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-381
  3. Canis lupus familiaris cfa-miR-381
  4. Capra hircus (goat) chi-miR-381
  5. Cavia porcellus (domestic guinea pig) cpo-miR-381-3p
  6. Cricetulus griseus cgr-miR-381
  7. Dasypus novemcinctus Dno-Mir-154-P9_3p (mature (guide))
  8. Daubentonia madagascariensis dma-miR-381
  9. Echinops telfairi Ete-Mir-154-P9_3p (mature (guide))
  10. Equus caballus (horse) eca-miR-381
  11. Homo sapiens (human) hsa-miR-381-3p
  12. Macaca mulatta mml-miR-381-3p
  13. Microcebus murinus (gray mouse lemur) mmr-miR-381
  14. Nomascus leucogenys nle-miR-381
  15. Oryctolagus cuniculus ocu-miR-381-3p
  16. Otolemur garnettii (small-eared galago) oga-miR-381
  17. Pan paniscus ppa-miR-381
  18. Pan troglodytes ptr-miR-381
  19. Papio hamadryas (hamadryas baboon) pha-miR-381
  20. Pongo pygmaeus ppy-miR-381
  21. Rattus norvegicus (Norway rat) Rno-Mir-154-P9_3p (mature (guide))
  22. Tupaia chinensis tch-miR-381-3p
Publications