Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (domestic guinea pig) cpo-miR-381-3p URS00001FFA8C_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUACAAGGGCAAGCUCUCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Bos taurus bta-miR-381
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-381
  3. Canis lupus familiaris cfa-miR-381
  4. Capra hircus (goat) chi-miR-381
  5. Cricetulus griseus cgr-miR-381
  6. Dasypus novemcinctus Dno-Mir-154-P9_3p (mature (guide))
  7. Daubentonia madagascariensis dma-miR-381
  8. Echinops telfairi Ete-Mir-154-P9_3p (mature (guide))
  9. Equus caballus (horse) eca-miR-381
  10. Homo sapiens (human) hsa-miR-381-3p
  11. Macaca mulatta mml-miR-381-3p
  12. Microcebus murinus (gray mouse lemur) mmr-miR-381
  13. Mus musculus (house mouse) mmu-miR-381-3p
  14. Nomascus leucogenys nle-miR-381
  15. Oryctolagus cuniculus ocu-miR-381-3p
  16. Otolemur garnettii (small-eared galago) oga-miR-381
  17. Pan paniscus ppa-miR-381
  18. Pan troglodytes ptr-miR-381
  19. Papio hamadryas (hamadryas baboon) pha-miR-381
  20. Pongo pygmaeus ppy-miR-381
  21. Rattus norvegicus (Norway rat) Rno-Mir-154-P9_3p (mature (guide))
  22. Tupaia chinensis tch-miR-381-3p