v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1-3p URS00001DC04F_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (LncBase, IntAct, MirGeneDB, ENA, GeneCards, miRBase, RefSeq, MalaCards, TarBase). Homo sapiens (human) hsa-miR-1-3p sequence is a product of MIR1-2, miR-1, MIR1-1, miR-1-3p, hsa-miR-1-3p, 1-2, miR-1-2, hsa-miR-1 genes. Found in the Homo sapiens reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8U, 101F10.1, 101F6, 11B6, 123F2, 12CC4, 14-3-3, 14-3-3-zeta, 156DAG, 16E1BP.

Interactions 63

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-1-3p interacts with:

Interaction id Participant Synonyms
EBI-20591562 intact:EBI-20557484 EBI-20557484 ENST00000256646.6 mrna_notch2
EBI-20557727 intact:EBI-20557484 EBI-20557484 ENST00000256646.6 mrna_notch2
EBI-20560453 intact:EBI-20560442 EBI-20560442 ENST00000225831.4 mrna_ccl2
EBI-20560676 intact:EBI-20560662 EBI-20560662 ENST00000539097.2 mrna_hif1a
EBI-20560959 intact:EBI-20560943 EBI-20560943 ENST00000373578.6 mrna_src
EBI-20562205 intact:EBI-20562147 EBI-20562147 ENST00000397752.7 mrna_cmet
EBI-20562162 intact:EBI-20562147 EBI-20562147 ENST00000397752.7 mrna_cmet
EBI-20626673 intact:EBI-20626719 EBI-20626719 ENST00000361505.9 mrna_pnp
EBI-20730291 intact:EBI-20733163 EBI-20733163 ENST00000263388.6 mrna_notch3
EBI-26972205 intact:EBI-26972157 EBI-26972157 ENST00000291270 mrna_dmpk
URS00001DC04F_9606-28 O75084 O75084
URS00001DC04F_9606-0 O75084 O75084
URS00001DC04F_9606-1 O95429 O95429
URS00001DC04F_9606-29 O95429 O95429
URS00001DC04F_9606-25 P05019 P05019
URS00001DC04F_9606-31 P05019 P05019
URS00001DC04F_9606-30 P05019 P05019
URS00001DC04F_9606-2 P05019 P05019
URS00001DC04F_9606-3 P05305 P05305
URS00001DC04F_9606-33 P05305 P05305
URS00001DC04F_9606-32 P05305 P05305
URS00001DC04F_9606-4 P05305 P05305
URS00001DC04F_9606-34 P08069 P08069
URS00001DC04F_9606-5 P08069 P08069
URS00001DC04F_9606-35 P08183 P08183
URS00001DC04F_9606-6 P08183 P08183
URS00001DC04F_9606-36 P0DP23 P0DP23
URS00001DC04F_9606-7 P0DP23 P0DP23
URS00001DC04F_9606-8 P0DP24 P0DP24
URS00001DC04F_9606-37 P0DP24 P0DP24
URS00001DC04F_9606-26 P11309 P11309
URS00001DC04F_9606-38 P11309 P11309
URS00001DC04F_9606-9 P15382 P15382
URS00001DC04F_9606-11 P17302 P17302
URS00001DC04F_9606-39 P17302 P17302
URS00001DC04F_9606-10 P17302 P17302
URS00001DC04F_9606-40 P17302 P17302
URS00001DC04F_9606-27 P23560 P23560
URS00001DC04F_9606-13 P23560 P23560
URS00001DC04F_9606-12 P23560 P23560
URS00001DC04F_9606-41 P35712 P35712
URS00001DC04F_9606-14 P35712 P35712
URS00001DC04F_9606-42 P48436 P48436
URS00001DC04F_9606-15 P48436 P48436
URS00001DC04F_9606-16 P56524 P56524
URS00001DC04F_9606-44 P63252 P63252
URS00001DC04F_9606-18 P63252 P63252
URS00001DC04F_9606-17 P63252 P63252
URS00001DC04F_9606-43 P63252 P63252
URS00001DC04F_9606-19 P78411 P78411
URS00001DC04F_9606-45 P78411 P78411
EBI-20560899 P84022 A8K4B6 B7Z4Z5 B7Z6M9 B7Z9Q2 EBI-1760241 EBI-1965323 EBI-347161 ENSP00000332973.4 F5H383 JV15-2 MADH3 O09064 O09144 O14510 O35273 P84022 Q92940 Q93002 Q9GKR4 SMAD family member 3 SMAD3 smad3_human
EBI-20560902 P84022 A8K4B6 B7Z4Z5 B7Z6M9 B7Z9Q2 EBI-1760241 EBI-1965323 EBI-347161 ENSP00000332973.4 F5H383 JV15-2 MADH3 O09064 O09144 O14510 O35273 P84022 Q92940 Q93002 Q9GKR4 SMAD family member 3 SMAD3 smad3_human
EBI-20560896 P84022 A8K4B6 B7Z4Z5 B7Z6M9 B7Z9Q2 EBI-1760241 EBI-1965323 EBI-347161 ENSP00000332973.4 F5H383 JV15-2 MADH3 O09064 O09144 O14510 O35273 P84022 Q92940 Q93002 Q9GKR4 SMAD family member 3 SMAD3 smad3_human
URS00001DC04F_9606-46 Q02078 Q02078
URS00001DC04F_9606-20 Q02078 Q02078
URS00001DC04F_9606-21 Q03060 Q03060
URS00001DC04F_9606-22 Q15172 Q15172
URS00001DC04F_9606-47 Q15172 Q15172
URS00001DC04F_9606-23 Q7Z699 Q7Z699
URS00001DC04F_9606-48 Q7Z699 Q7Z699
URS00001DC04F_9606-49 Q8WU20 Q8WU20
URS00001DC04F_9606-24 Q8WU20 Q8WU20

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGGAAUGUAAAGAAGUAUGUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 64 other species

    1. Alligator mississippiensis (American alligator) ami-miR-1a-3p
    2. Anolis carolinensis (green anole) aca-miR-1a-3p
    3. Bos taurus bta-miR-1
    4. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-1-5p
    5. Branchiostoma floridae (Florida lancelet) bfl-miR-1-3p
    6. Branchiostoma lanceolatum (amphioxus) Bla-Mir-1_3p (mature (guide))
    7. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1a
    8. Callorhinchus milii Cmi-Mir-1-P4_3p (mature (guide))
    9. Canis lupus familiaris Cfa-Mir-1-P1_3p (mature (guide))
    10. Capra hircus (goat) chi-miR-1
    11. Cavia porcellus cpo-miR-1a-3p
    12. Chrysemys picta bellii Cpi-Mir-1-P1_3p (mature (guide))
    13. Chrysemys picta (Painted turtle) cpi-miR-1a-3p
    14. Columba livia (rock pigeon) cli-miR-1a-3p
    15. Crassostrea gigas Cgi-Mir-1_3p (mature (guide))
    16. Cyprinus carpio ccr-miR-1
    17. Danio rerio dre-miR-1
    18. Dasypus novemcinctus (nine-banded armadillo) dno-miR-1-3p
    19. Echinops telfairi Ete-Mir-1-P1_3p (mature (guide))
    20. Eptatretus burgeri Ebu-Mir-1-P7_3p (mature (guide))
    21. Eptesicus fuscus (big brown bat) efu-miR-1
    22. Equus caballus eca-miR-1
    23. Gadus morhua (Atlantic cod) gmo-miR-1-3p
    24. Gallus gallus (chicken) Gga-Mir-1-P1_3p (mature (guide))
    25. Gekko japonicus Gja-Mir-1-P1_3p (mature (guide))
    26. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-1
    27. Hippoglossus hippoglossus hhi-miR-1
    28. Latimeria chalumnae (coelacanth) Lch-Mir-1-P1_3p (mature (guide))
    29. Lepisosteus oculatus (spotted gar) Loc-Mir-1-P1_3p (mature (guide))
    30. Lottia gigantea (owl limpet) lgi-miR-1
    31. Lytechinus variegatus lva-miR-1-3p
    32. Macaca mulatta (Rhesus monkey) mml-miR-1-3p
    33. Maylandia zebra (zebra mbuna) mze-miR-1
    34. Melibe leonina mle-miR-1-3p
    35. Microcaecilia unicolor Mun-Mir-1-P1_3p (mature (guide))
    36. Monodelphis domestica (gray short-tailed opossum) mdo-miR-1-3p
    37. Monopterus albus Mal-Mir-1-P1_3p (mature (guide))
    38. Mus musculus mmu-miR-1a-3p
    39. Nautilus pompilius Npo-Mir-1-P20_3p (mature (guide))
    40. Neolamprologus brichardi nbr-miR-1
    41. Ophiophagus hannah oha-miR-1b-3p
    42. Oreochromis niloticus (Nile tilapia) oni-miR-1
    43. Ornithorhynchus anatinus (platypus) oan-miR-1a-3p
    44. Oryctolagus cuniculus ocu-miR-1-3p
    45. Pan troglodytes ptr-miR-1
    46. Paralichthys olivaceus pol-miR-1-3p
    47. Patiria miniata pmi-miR-1-3p
    48. Petromyzon marinus (sea lamprey) Pma-Mir-1-o3_3p (mature (guide))
    49. Pongo pygmaeus ppy-miR-1
    50. Pteropus alecto (black flying fox) pal-miR-1-3p
    51. Pundamilia nyererei pny-miR-1
    52. Python bivittatus Pbv-Mir-1-P3_3p (mature (guide))
    53. Rattus norvegicus (Norway rat) rno-miR-1b
    54. Salmo salar ssa-miR-1-3p
    55. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-1-P1_3p (mature (guide))
    56. Scyliorhinus torazame (cloudy catshark) Sto-Mir-1-P1_3p (mature (guide))
    57. Sphenodon punctatus (tuatara) Spt-Mir-1-P1_3p (mature (guide))
    58. Strongylocentrotus purpuratus spu-miR-1
    59. Taeniopygia guttata (zebra finch) tgu-miR-1-3p
    60. Takifugu rubripes fru-miR-1
    61. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-1
    62. Tor tambroides (Thai mahseer) miR-1
    63. Xenopus laevis xla-miR-1a-3p
    64. Xenopus tropicalis Xtr-Mir-1-P1_3p (mature (guide))
     Publications