v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-1b URS00001DC04F_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-1: Rno-mir-1 is a type of microRNA that has been studied in various contexts. It has been used in Taqman® MicroRNA assays [PMC4686181] and quantitative PCR experiments [PMC4684496]. Rno-mir-1 is up-regulated and a target of rno-miR-9a-5p, rno-mir-1, and rno-mir-181d [PMC6377737]. It has been found to be highly expressed in the heart [PMC4978447]. Rno-mir-1 has also been used in qPCR assays for gene expression analysis, along with other targets such as U6 snRNA and BDNF [PMC4482165] [PMC7671483]. Additionally, rno-mir-1 has been associated with muscle damage [PMC8933690]. It has also been synthesized for experimental purposes by Jima Inc. [PMC3066105]. Rno-mir-1 is predicted to target BDNF, a growth factor involved in synaptic plasticity [PMC2832745]. It has also been transfected into cells for functional studies along with other microRNAs such as rno-mir-133a [PMC3823095]. Rno-mir-1 can be detected using TaqMan microRNA assay reagents or SYBR green based qPCR with specific primers for miR-1 [PMC5796571] [PMC4024745] [PMC3823166]. Overall, rno-mir-1 is a well-studied microRNA that plays various roles in different biological contexts.

mRNA interactions 6 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAUGUAAAGAAGUAUGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 64 other species

  1. Alligator mississippiensis ami-miR-1a-3p
  2. Anolis carolinensis (green anole) aca-miR-1a-3p
  3. Bos taurus (cattle) bta-miR-1
  4. Branchiostoma belcheri bbe-miR-1-5p
  5. Branchiostoma floridae (Florida lancelet) bfl-miR-1-3p
  6. Branchiostoma lanceolatum Bla-Mir-1_3p (mature (guide))
  7. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1a
  8. Callorhinchus milii Cmi-Mir-1-P4_3p (mature (guide))
  9. Canis lupus familiaris Cfa-Mir-1-P1_3p (mature (guide))
  10. Capra hircus (goat) chi-miR-1
  11. Cavia porcellus (domestic guinea pig) cpo-miR-1a-3p
  12. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P1_3p (mature (guide))
  13. Chrysemys picta cpi-miR-1a-3p
  14. Columba livia cli-miR-1a-3p
  15. Crassostrea gigas (Pacific oyster) Cgi-Mir-1_3p (mature (guide))
  16. Cyprinus carpio ccr-miR-1
  17. Danio rerio dre-miR-1
  18. Dasypus novemcinctus dno-miR-1-3p
  19. Echinops telfairi Ete-Mir-1-P1_3p (mature (guide))
  20. Eptatretus burgeri Ebu-Mir-1-P7_3p (mature (guide))
  21. Eptesicus fuscus (big brown bat) efu-miR-1
  22. Equus caballus (horse) eca-miR-1
  23. Gadus morhua (Atlantic cod) gmo-miR-1-3p
  24. Gallus gallus Gga-Mir-1-P1_3p (mature (guide))
  25. Gekko japonicus Gja-Mir-1-P1_3p (mature (guide))
  26. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-1
  27. Hippoglossus hippoglossus hhi-miR-1
  28. Homo sapiens (human) hsa-miR-1-3p
  29. Latimeria chalumnae Lch-Mir-1-P1_3p (mature (guide))
  30. Lepisosteus oculatus (spotted gar) Loc-Mir-1-P1_3p (mature (guide))
  31. Lottia gigantea (owl limpet) lgi-miR-1
  32. Lytechinus variegatus (green sea urchin) lva-miR-1-3p
  33. Macaca mulatta mml-miR-1-3p
  34. Maylandia zebra (zebra mbuna) mze-miR-1
  35. Melibe leonina mle-miR-1-3p
  36. Microcaecilia unicolor Mun-Mir-1-P1_3p (mature (guide))
  37. Monodelphis domestica (gray short-tailed opossum) mdo-miR-1-3p
  38. Monopterus albus (swamp eel) Mal-Mir-1-P1_3p (mature (guide))
  39. Mus musculus mmu-miR-1a-3p
  40. Nautilus pompilius Npo-Mir-1-P20_3p (mature (guide))
  41. Neolamprologus brichardi (lyretail cichlid) nbr-miR-1
  42. Ophiophagus hannah (king cobra) oha-miR-1b-3p
  43. Oreochromis niloticus (Nile tilapia) oni-miR-1
  44. Ornithorhynchus anatinus oan-miR-1a-3p
  45. Oryctolagus cuniculus (rabbit) ocu-miR-1-3p
  46. Pan troglodytes ptr-miR-1
  47. Paralichthys olivaceus (Japanese flounder) pol-miR-1-3p
  48. Patiria miniata (sea bat) pmi-miR-1-3p
  49. Petromyzon marinus (sea lamprey) Pma-Mir-1-o3_3p (mature (guide))
  50. Pongo pygmaeus ppy-miR-1
  51. Pteropus alecto (black flying fox) pal-miR-1-3p
  52. Pundamilia nyererei pny-miR-1
  53. Python bivittatus Pbv-Mir-1-P3_3p (mature (guide))
  54. Salmo salar (Atlantic salmon) ssa-miR-1-3p
  55. Sarcophilus harrisii Sha-Mir-1-P1_3p (mature (guide))
  56. Scyliorhinus torazame Sto-Mir-1-P1_3p (mature (guide))
  57. Sphenodon punctatus Spt-Mir-1-P1_3p (mature (guide))
  58. Strongylocentrotus purpuratus spu-miR-1
  59. Taeniopygia guttata (zebra finch) tgu-miR-1-3p
  60. Takifugu rubripes fru-miR-1
  61. Tetraodon nigroviridis tni-miR-1
  62. Tor tambroides miR-1
  63. Xenopus laevis (African clawed frog) xla-miR-1a-3p
  64. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-1-P1_3p (mature (guide))
 Publications