Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-1 URS00001DC04F_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-1: Bta-mir-1 is a specific-related skeletal muscle development miRNA [PMC7802253]. Bta-mir-1 is also more highly expressed than bta-miR-365-3p in early myoblast differentiation, suggesting its importance in the early differentiation stage [PMC7802253]. Bta-miR-365-3p, on the other hand, has higher expression in adult muscle tissues compared to fetal stages, similar to bta-mir-1 [PMC7802253]. Bta-mir-1 is downregulated in extracellular vesicles (EVs) released by competent embryos and upregulated in EVs secreted by arrested embryos [PMC7727673]. It has been proposed that upregulated miRNAs like bta-mir-1 in EVs from good-quality embryos may block cell functions required for normal embryo development [PMC7727673]. Bta-mir-1 has also been detected in the culture medium of bovine embryos and is related to embryo competence [PMC7727673]. Oil treatment has negligible effects on miRNA expression, except for a differential expression of bta-mir-1 between control and CLA groups on day -21 AP [PMC9445238]. Bta-mir-143 is the most significantly upregulated miRNA, while bta-mir-187 is the most significantly downregulated miRNA [PMC9445238]. Bta-miR-206 and bta-miR133a are muscle-specific miRNAs that are highly expressed in bovine skeletal muscles and have been detected frequently across different studies [PMC5003961] [PMC5996145]. The binding site of circ0014518 and bta-mir-1 has been verified using a double luciferase reporter gene system [PMC7726199]. Bta-mir-1, along with bta-mir-133a, bta-mir-206, and bta-mir-378, may contribute to the regulation of muscle growth and phenotype [PMC4090223].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAAGAAGUAUGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 64 other species

  1. Alligator mississippiensis ami-miR-1a-3p
  2. Anolis carolinensis (green anole) aca-miR-1a-3p
  3. Branchiostoma belcheri bbe-miR-1-5p
  4. Branchiostoma floridae (Florida lancelet) bfl-miR-1-3p
  5. Branchiostoma lanceolatum Bla-Mir-1_3p (mature (guide))
  6. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1a
  7. Callorhinchus milii Cmi-Mir-1-P4_3p (mature (guide))
  8. Canis lupus familiaris Cfa-Mir-1-P1_3p (mature (guide))
  9. Capra hircus (goat) chi-miR-1
  10. Cavia porcellus (domestic guinea pig) cpo-miR-1a-3p
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P1_3p (mature (guide))
  12. Chrysemys picta cpi-miR-1a-3p
  13. Columba livia cli-miR-1a-3p
  14. Crassostrea gigas (Pacific oyster) Cgi-Mir-1_3p (mature (guide))
  15. Cyprinus carpio ccr-miR-1
  16. Danio rerio dre-miR-1
  17. Dasypus novemcinctus dno-miR-1-3p
  18. Echinops telfairi Ete-Mir-1-P1_3p (mature (guide))
  19. Eptatretus burgeri Ebu-Mir-1-P7_3p (mature (guide))
  20. Eptesicus fuscus (big brown bat) efu-miR-1
  21. Equus caballus (horse) eca-miR-1
  22. Gadus morhua (Atlantic cod) gmo-miR-1-3p
  23. Gallus gallus Gga-Mir-1-P1_3p (mature (guide))
  24. Gekko japonicus Gja-Mir-1-P1_3p (mature (guide))
  25. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-1
  26. Hippoglossus hippoglossus hhi-miR-1
  27. Homo sapiens (human) hsa-miR-1-3p
  28. Latimeria chalumnae Lch-Mir-1-P1_3p (mature (guide))
  29. Lepisosteus oculatus (spotted gar) Loc-Mir-1-P1_3p (mature (guide))
  30. Lottia gigantea (owl limpet) lgi-miR-1
  31. Lytechinus variegatus (green sea urchin) lva-miR-1-3p
  32. Macaca mulatta mml-miR-1-3p
  33. Maylandia zebra (zebra mbuna) mze-miR-1
  34. Melibe leonina mle-miR-1-3p
  35. Microcaecilia unicolor Mun-Mir-1-P1_3p (mature (guide))
  36. Monodelphis domestica (gray short-tailed opossum) mdo-miR-1-3p
  37. Monopterus albus (swamp eel) Mal-Mir-1-P1_3p (mature (guide))
  38. Mus musculus mmu-miR-1a-3p
  39. Nautilus pompilius Npo-Mir-1-P20_3p (mature (guide))
  40. Neolamprologus brichardi (lyretail cichlid) nbr-miR-1
  41. Ophiophagus hannah (king cobra) oha-miR-1b-3p
  42. Oreochromis niloticus (Nile tilapia) oni-miR-1
  43. Ornithorhynchus anatinus oan-miR-1a-3p
  44. Oryctolagus cuniculus (rabbit) ocu-miR-1-3p
  45. Pan troglodytes ptr-miR-1
  46. Paralichthys olivaceus (Japanese flounder) pol-miR-1-3p
  47. Patiria miniata (sea bat) pmi-miR-1-3p
  48. Petromyzon marinus (sea lamprey) Pma-Mir-1-o3_3p (mature (guide))
  49. Pongo pygmaeus ppy-miR-1
  50. Pteropus alecto (black flying fox) pal-miR-1-3p
  51. Pundamilia nyererei pny-miR-1
  52. Python bivittatus Pbv-Mir-1-P3_3p (mature (guide))
  53. Rattus norvegicus rno-miR-1b
  54. Salmo salar (Atlantic salmon) ssa-miR-1-3p
  55. Sarcophilus harrisii Sha-Mir-1-P1_3p (mature (guide))
  56. Scyliorhinus torazame Sto-Mir-1-P1_3p (mature (guide))
  57. Sphenodon punctatus Spt-Mir-1-P1_3p (mature (guide))
  58. Strongylocentrotus purpuratus spu-miR-1
  59. Taeniopygia guttata (zebra finch) tgu-miR-1-3p
  60. Takifugu rubripes fru-miR-1
  61. Tetraodon nigroviridis tni-miR-1
  62. Tor tambroides miR-1
  63. Xenopus laevis (African clawed frog) xla-miR-1a-3p
  64. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-1-P1_3p (mature (guide))
Publications