Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-1 URS00001DC04F_9600

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ppy-miR-1: Ppy-mir-1 is a microRNA that has been studied in relation to antler growth. The KEGG pathway annotation revealed that ppy-mir-1, along with other miRNAs, is significantly associated with various signaling pathways such as the Ras signaling pathway, Neurotrophin signaling pathway, Glioma, Pathways in cancer, and Thyroid hormone signaling pathway [PMC9957509]. In a comparison of different growth stages of antlers, ppy-mir-1 was found to be highly expressed at 30 and 90 days of growth but lowly expressed at 60 days [PMC9957509]. The expression pattern of ppy-mir-1 suggests its potential involvement in the rapid growth and ossification of antlers [PMC9957509]. Target gene prediction revealed that ppy-mir-1 is associated with 821 target genes [PMC9957509]. Additionally, the expression levels of other miRNAs such as mmu-miR-200b-3p and novel miR-94 also showed a similar pattern to ppy-mir-1 and may play crucial roles in antler development [PMC9957509]. Furthermore, the expression trends observed in small RNA sequencing data support the accuracy of the findings [PMC9957509]. In conclusion, ppy-mir-1 is a differentially expressed microRNA that may be closely related to antler growth and development. Its involvement in various signaling pathways suggests its potential importance in regulating key processes during antler development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAAGAAGUAUGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 64 other species

  1. Alligator mississippiensis ami-miR-1a-3p
  2. Anolis carolinensis (green anole) aca-miR-1a-3p
  3. Bos taurus (cattle) bta-miR-1
  4. Branchiostoma belcheri bbe-miR-1-5p
  5. Branchiostoma floridae (Florida lancelet) bfl-miR-1-3p
  6. Branchiostoma lanceolatum Bla-Mir-1_3p (mature (guide))
  7. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1a
  8. Callorhinchus milii Cmi-Mir-1-P4_3p (mature (guide))
  9. Canis lupus familiaris Cfa-Mir-1-P1_3p (mature (guide))
  10. Capra hircus (goat) chi-miR-1
  11. Cavia porcellus (domestic guinea pig) cpo-miR-1a-3p
  12. Chrysemys picta bellii (western painted turtle) Cpi-Mir-1-P1_3p (mature (guide))
  13. Chrysemys picta cpi-miR-1a-3p
  14. Columba livia cli-miR-1a-3p
  15. Crassostrea gigas (Pacific oyster) Cgi-Mir-1_3p (mature (guide))
  16. Cyprinus carpio ccr-miR-1
  17. Danio rerio dre-miR-1
  18. Dasypus novemcinctus dno-miR-1-3p
  19. Echinops telfairi Ete-Mir-1-P1_3p (mature (guide))
  20. Eptatretus burgeri Ebu-Mir-1-P7_3p (mature (guide))
  21. Eptesicus fuscus (big brown bat) efu-miR-1
  22. Equus caballus (horse) eca-miR-1
  23. Gadus morhua (Atlantic cod) gmo-miR-1-3p
  24. Gallus gallus Gga-Mir-1-P1_3p (mature (guide))
  25. Gekko japonicus Gja-Mir-1-P1_3p (mature (guide))
  26. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-1
  27. Hippoglossus hippoglossus hhi-miR-1
  28. Homo sapiens (human) hsa-miR-1-3p
  29. Latimeria chalumnae Lch-Mir-1-P1_3p (mature (guide))
  30. Lepisosteus oculatus (spotted gar) Loc-Mir-1-P1_3p (mature (guide))
  31. Lottia gigantea (owl limpet) lgi-miR-1
  32. Lytechinus variegatus (green sea urchin) lva-miR-1-3p
  33. Macaca mulatta mml-miR-1-3p
  34. Maylandia zebra (zebra mbuna) mze-miR-1
  35. Melibe leonina mle-miR-1-3p
  36. Microcaecilia unicolor Mun-Mir-1-P1_3p (mature (guide))
  37. Monodelphis domestica (gray short-tailed opossum) mdo-miR-1-3p
  38. Monopterus albus (swamp eel) Mal-Mir-1-P1_3p (mature (guide))
  39. Mus musculus mmu-miR-1a-3p
  40. Nautilus pompilius Npo-Mir-1-P20_3p (mature (guide))
  41. Neolamprologus brichardi (lyretail cichlid) nbr-miR-1
  42. Ophiophagus hannah (king cobra) oha-miR-1b-3p
  43. Oreochromis niloticus (Nile tilapia) oni-miR-1
  44. Ornithorhynchus anatinus oan-miR-1a-3p
  45. Oryctolagus cuniculus (rabbit) ocu-miR-1-3p
  46. Pan troglodytes ptr-miR-1
  47. Paralichthys olivaceus (Japanese flounder) pol-miR-1-3p
  48. Patiria miniata (sea bat) pmi-miR-1-3p
  49. Petromyzon marinus (sea lamprey) Pma-Mir-1-o3_3p (mature (guide))
  50. Pteropus alecto (black flying fox) pal-miR-1-3p
  51. Pundamilia nyererei pny-miR-1
  52. Python bivittatus Pbv-Mir-1-P3_3p (mature (guide))
  53. Rattus norvegicus rno-miR-1b
  54. Salmo salar (Atlantic salmon) ssa-miR-1-3p
  55. Sarcophilus harrisii Sha-Mir-1-P1_3p (mature (guide))
  56. Scyliorhinus torazame Sto-Mir-1-P1_3p (mature (guide))
  57. Sphenodon punctatus Spt-Mir-1-P1_3p (mature (guide))
  58. Strongylocentrotus purpuratus spu-miR-1
  59. Taeniopygia guttata (zebra finch) tgu-miR-1-3p
  60. Takifugu rubripes fru-miR-1
  61. Tetraodon nigroviridis tni-miR-1
  62. Tor tambroides miR-1
  63. Xenopus laevis (African clawed frog) xla-miR-1a-3p
  64. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-1-P1_3p (mature (guide))
Publications