Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Hypericum perforatum Hyp-miR396 URS00001D441B_65561

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCACAGCUUUCUUGAACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Aegilops tauschii ata-miR396c-5p
  2. Amborella trichopoda atr-miR396e
  3. Ananas comosus (pineapple) sbi-miR396c
  4. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR396b
  5. Arabidopsis lyrata (lyrate rockcress) aly-miR396b-5p
  6. Arabidopsis thaliana ath-miR396b-5p
  7. Avicennia marina ama-miR396-5p
  8. Brachypodium distachyon bdi-miR396e-5p
  9. Brassica napus bna-miR396a
  10. Brassica rapa bra-miR396-5p
  11. Bruguiera cylindrica bcy-miR396b
  12. Bruguiera gymnorhiza (Burma mangrove) bgy-miR396b
  13. Camelina sativa (false flax) cas-miR396b
  14. Citrus sinensis (sweet orange) csi-miR396f-5p
  15. Citrus x clementina (clementine) ccl-miR396
  16. Corchorus capsularis (jute) sRNA CCACVL1_27830
  17. Corchorus olitorius aau-miR3
  18. Cucumis melo (muskmelon) cme-miR396d
  19. Cynara cardunculus (wild artichoke) cca-miR396a-5p
  20. Fragaria vesca subsp. vesca fve-miR396b-5p
  21. Glycine max gma-miR396c
  22. Helianthus annuus ath-miR396b-5p
  23. Linum usitatissimum lus-miR396e
  24. Malus domestica (apple) mdm-miR396d
  25. Manihot esculenta mes-miR396f
  26. Medicago truncatula mtr-miR396a-5p
  27. Nicotiana attenuata microRNA mir-396-like
  28. Nicotiana tabacum (common tobacco) nta-miR396b
  29. Oryza alta miR396c 5p
  30. Oryza australiensis miR396c 5p
  31. Oryza barthii miR396c 5p
  32. Oryza glaberrima miR396c 5p
  33. Oryza minuta miR396c 5p
  34. Oryza nivara miR396c 5p
  35. Oryza rufipogon miR396c 5p
  36. Oryza sativa (Asian cultivated rice) osa-miR396c-5p
  37. Oryza sativa Indica Group miR396c 5p
  38. Oryza sativa Japonica Group (Japanese rice) miR396c 5p
  39. Pachycladon cheesemanii Pch-miR396b
  40. Pachycladon fastigiatum Pfa-miR396b
  41. Picea abies pab-miR396h
  42. Pinus taeda pta-miR396
  43. Populus tomentosa Pto-miR396d
  44. Populus trichocarpa (black cottonwood) ptc-miR396d
  45. Prunus persica (peach) ppe-miR396b
  46. Ricinus communis rco-miR396
  47. Rosa chinensis ath-miR396b-5p
  48. Solanum lycopersicum (tomato) sly-miR396b
  49. Solanum tuberosum stu-miR396-5p
  50. Sorghum bicolor (sorghum) sbi-miR396c
  51. Theobroma cacao tcc-miR396e
  52. Zea mays (maize) zma-miR396f-5p