v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Glycine max (soybean) gma-miR396c URS00001D441B_3847

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gma-miR396b-5p: Gma-mir396b-5p is a highly abundant conserved miRNA in soybean [PMC6888636]. The expression levels of ten target genes of six Cd-responsive miRNAs, including gma-mir396b-5p, were measured in Cd tolerant and Cd sensitive soybean roots [PMC3867309]. A total of 26 Cd-responsive miRNAs were identified, and gma-mir396b-5p showed similar alteration patterns in response to Cd stress as observed in rice and Brassica [PMC3867309]. Eight miRNAs, including gma-mir396b-5p, were down-regulated in both genotypes with a more than 2-fold change response to Cd stress [PMC3867309]. In contrast to gma-mir396b-5p, other members of the miR396 family showed up-regulation in both genotypes [PMC3867309]. The expression of gma-mir396b-5p showed an indirect correlation with its target genes [PMC3867309]. The expression patterns of gma-mir396b-5p in the two soybean genotypes were similar to that of miR396 in rice [PMC3867309]. Additionally, gma-mir396b-5p was highly abundant and played an essential role in the root apical meristem (RAM) of soybean [PMC4716665].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCCACAGCUUUCUUGAACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Aegilops tauschii ata-miR396c-5p
  2. Amborella trichopoda atr-miR396e
  3. Ananas comosus (pineapple) sbi-miR396c
  4. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR396b
  5. Arabidopsis lyrata (lyrate rockcress) aly-miR396b-5p
  6. Arabidopsis thaliana ath-miR396b-5p
  7. Avicennia marina ama-miR396-5p
  8. Brachypodium distachyon bdi-miR396e-5p
  9. Brassica napus bna-miR396a
  10. Brassica rapa bra-miR396-5p
  11. Bruguiera cylindrica bcy-miR396b
  12. Bruguiera gymnorhiza (Burma mangrove) bgy-miR396b
  13. Camelina sativa (false flax) cas-miR396b
  14. Citrus sinensis (sweet orange) csi-miR396f-5p
  15. Citrus x clementina (clementine) ccl-miR396
  16. Corchorus capsularis (jute) sRNA CCACVL1_27830
  17. Corchorus olitorius aau-miR3
  18. Cucumis melo (muskmelon) cme-miR396d
  19. Cynara cardunculus (wild artichoke) cca-miR396a-5p
  20. Fragaria vesca subsp. vesca fve-miR396b-5p
  21. Helianthus annuus ath-miR396b-5p
  22. Hypericum perforatum Hyp-miR396
  23. Linum usitatissimum lus-miR396e
  24. Malus domestica (apple) mdm-miR396d
  25. Manihot esculenta mes-miR396f
  26. Medicago truncatula mtr-miR396a-5p
  27. Nicotiana attenuata microRNA mir-396-like
  28. Nicotiana tabacum (common tobacco) nta-miR396b
  29. Oryza alta miR396c 5p
  30. Oryza australiensis miR396c 5p
  31. Oryza barthii miR396c 5p
  32. Oryza glaberrima miR396c 5p
  33. Oryza minuta miR396c 5p
  34. Oryza nivara miR396c 5p
  35. Oryza rufipogon miR396c 5p
  36. Oryza sativa (Asian cultivated rice) osa-miR396c-5p
  37. Oryza sativa Indica Group miR396c 5p
  38. Oryza sativa Japonica Group (Japanese rice) miR396c 5p
  39. Pachycladon cheesemanii Pch-miR396b
  40. Pachycladon fastigiatum Pfa-miR396b
  41. Picea abies pab-miR396h
  42. Pinus taeda pta-miR396
  43. Populus tomentosa Pto-miR396d
  44. Populus trichocarpa (black cottonwood) ptc-miR396d
  45. Prunus persica (peach) ppe-miR396b
  46. Ricinus communis rco-miR396
  47. Rosa chinensis ath-miR396b-5p
  48. Solanum lycopersicum (tomato) sly-miR396b
  49. Solanum tuberosum stu-miR396-5p
  50. Sorghum bicolor (sorghum) sbi-miR396c
  51. Theobroma cacao tcc-miR396e
  52. Zea mays (maize) zma-miR396f-5p
 Publications