Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Solanum tuberosum (potato) stu-miR396-5p URS00001D441B_4113

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

stu-miR396-5p: Stu-mir396-5p is a type of microRNA that shows a significant decrease in expression from the seedling stage to the budding stage in potato plants, particularly in the Yanshu4 variety, when subjected to different levels of nitrogen (N) application [PMC9547441]. There is a potential binding site between stu-mir396-5p and StNiR, and a splicing relationship between the 8th base of stu-mir396-5p and the 8th base of StNiR from the 5' end of stu-mir396-5p [PMC9547441]. This suggests a negative correlation between stu-mir396-5p and StNiR under N stress conditions [PMC9547441]. In addition, under salt stress conditions, stu-mir396-5p is down-regulated in both roots and leaves of "Xushu 22" potato plants, as revealed by qRT-PCR analysis [PMC9302446]. Degradome sequencing further identified that stu-mir396-5p targets growth-regulating factor (GRF) family members such as GRF2, GRF3, and GRF6 [PMC9302446]. Furthermore, differential expression analysis showed that LN_YLS had the largest proportion of differences in stu-mir396-5p expression under treatment conditions [PMC9547441]. In summary, stu-mir396-5p is a microRNA that exhibits decreased expression during different developmental stages and under various stress conditions in potato plants. It shows potential interactions with StNiR and targets GRF family members. The differential expression analysis suggests significant variations in its expression levels depending on nitrogen application levels.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCACAGCUUUCUUGAACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Aegilops tauschii ata-miR396c-5p
  2. Amborella trichopoda atr-miR396e
  3. Ananas comosus (pineapple) sbi-miR396c
  4. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR396b
  5. Arabidopsis lyrata (lyrate rockcress) aly-miR396b-5p
  6. Arabidopsis thaliana ath-miR396b-5p
  7. Avicennia marina ama-miR396-5p
  8. Brachypodium distachyon bdi-miR396e-5p
  9. Brassica napus bna-miR396a
  10. Brassica rapa bra-miR396-5p
  11. Bruguiera cylindrica bcy-miR396b
  12. Bruguiera gymnorhiza (Burma mangrove) bgy-miR396b
  13. Camelina sativa (false flax) cas-miR396b
  14. Citrus sinensis (sweet orange) csi-miR396f-5p
  15. Citrus x clementina (clementine) ccl-miR396
  16. Corchorus capsularis (jute) sRNA CCACVL1_27830
  17. Corchorus olitorius aau-miR3
  18. Cucumis melo (muskmelon) cme-miR396d
  19. Cynara cardunculus (wild artichoke) cca-miR396a-5p
  20. Fragaria vesca subsp. vesca fve-miR396b-5p
  21. Glycine max gma-miR396c
  22. Helianthus annuus ath-miR396b-5p
  23. Hypericum perforatum Hyp-miR396
  24. Linum usitatissimum lus-miR396e
  25. Malus domestica (apple) mdm-miR396d
  26. Manihot esculenta mes-miR396f
  27. Medicago truncatula mtr-miR396a-5p
  28. Nicotiana attenuata microRNA mir-396-like
  29. Nicotiana tabacum (common tobacco) nta-miR396b
  30. Oryza alta miR396c 5p
  31. Oryza australiensis miR396c 5p
  32. Oryza barthii miR396c 5p
  33. Oryza glaberrima miR396c 5p
  34. Oryza minuta miR396c 5p
  35. Oryza nivara miR396c 5p
  36. Oryza rufipogon miR396c 5p
  37. Oryza sativa (Asian cultivated rice) osa-miR396c-5p
  38. Oryza sativa Indica Group miR396c 5p
  39. Oryza sativa Japonica Group (Japanese rice) miR396c 5p
  40. Pachycladon cheesemanii Pch-miR396b
  41. Pachycladon fastigiatum Pfa-miR396b
  42. Picea abies pab-miR396h
  43. Pinus taeda pta-miR396
  44. Populus tomentosa Pto-miR396d
  45. Populus trichocarpa (black cottonwood) ptc-miR396d
  46. Prunus persica (peach) ppe-miR396b
  47. Ricinus communis rco-miR396
  48. Rosa chinensis ath-miR396b-5p
  49. Solanum lycopersicum (tomato) sly-miR396b
  50. Sorghum bicolor (sorghum) sbi-miR396c
  51. Theobroma cacao tcc-miR396e
  52. Zea mays (maize) zma-miR396f-5p
Publications