Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-200c-3p URS0000192F9C_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (miRBase, ENA, IntAct, PSICQUIC, GeneCards, MirGeneDB, MalaCards, LncBase, TarBase, RefSeq). Described in 113 papers. Homo sapiens (human) hsa-miR-200c-3p sequence is a product of MIR200C, hsa-miR-200c-3p, hsa-miR-200c, miR-200c, miR-200, miR-200c-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3GAMMA, 14-3-3γ, 16.3A5, 18A2, 1A1-3B, 3'HEXO, 42A, 4EHP, 5-HT7, 7h3.

Interactions 25

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-200c-3p interacts with:

Interaction id Participant Synonyms
EBI-25420127 intact:EBI-25420098 EBI-25420098 ENST00000627532 mrna_zeb2
EBI-25466435 URS0000811F6D_9606 EBI-25438148 URS0000811F6D_9606 lnc_arsr-1
EBI-25466475 URS0000811F6D_9606 EBI-25438148 URS0000811F6D_9606 lnc_arsr-1
EBI-25505106 intact:EBI-25505109 EBI-25505109 ENST00000427411 mrna_ace2
URS0000192F9C_9606-0 O95760 O95760
URS0000192F9C_9606-11 O95760 O95760
URS0000192F9C_9606-1 P05067 P05067
URS0000192F9C_9606-12 P05067 P05067
URS0000192F9C_9606-2 P05231 P05231
URS0000192F9C_9606-13 P05231 P05231
URS0000192F9C_9606-14 P10145 P10145
URS0000192F9C_9606-3 P10145 P10145
URS0000192F9C_9606-15 P13501 P13501
URS0000192F9C_9606-4 P13501 P13501
URS0000192F9C_9606-16 P35968 P35968
URS0000192F9C_9606-5 P35968 P35968
URS0000192F9C_9606-17 P37275 P37275
URS0000192F9C_9606-6 P37275 P37275
URS0000192F9C_9606-18 P60484 P60484
URS0000192F9C_9606-7 P60484 P60484
URS0000192F9C_9606-9 Q01130 Q01130
URS0000192F9C_9606-19 Q01130 Q01130
URS0000192F9C_9606-10 Q07954 Q07954
URS0000192F9C_9606-8 Q13936 Q13936
URS0000192F9C_9606-20 Q13936 Q13936

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAUACUGCCGGGUAAUGAUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 120 other species

    1. Bos taurus bta-miR-200c
    2. Callithrix jacchus cja-miR-200c
    3. Canis lupus familiaris cfa-miR-200c
    4. Capra hircus (goat) chi-miR-200c
    5. Cavia porcellus cpo-miR-200c-3p
    6. Cervus elaphus (red deer) cel-miR-200c
    7. Cricetulus griseus cgr-miR-200c
    8. Echinops telfairi Ete-Mir-8-P1b_3p (mature (guide))
    9. Eptesicus fuscus (big brown bat) efu-miR-200c
    10. Equus caballus (horse) eca-miR-200c
    11. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-384324
    12. Macaca mulatta (Rhesus monkey) Mml-Mir-8-P1b_3p (mature (guide))
    13. Monodelphis domestica Mdo-Mir-8-P1b_3p (mature (guide))
    14. Mus musculus mmu-miR-200c-3p
    15. Oryctolagus cuniculus ocu-miR-200c-3p
    16. Pan troglodytes ptr-miR-200c
    17. Pteropus alecto (black flying fox) pal-miR-200c-3p
    18. Rattus norvegicus Rno-Mir-8-P1b_3p (mature (guide))
    19. Tupaia chinensis tch-miR-200c-3p
    Publications New