Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-200c-3p URS0000192F9C_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-200c: Mmu-mir-200c is a type of miRNA that has been studied in various contexts. In one study, 20 pmol of mmu-mir-200c was used in a dilution with siPORT to investigate its effects [PMC3789096]. It has been identified as one of the tooth tissue-specific miRNAs, along with hsa-miR-133a, hsa-miR-200b, hsa-miR-206, and hsa-miR-218 [PMC4696248]. In the context of obesity, mmu-mir-200c was found to be differentially expressed and its downregulation could be reversed by low-fat diet treatment [PMC4571067]. Mmu-mir-200c has also been studied in the context of stem cell pluripotency and its activation by Pou5f1 [PMC9505168]. It was included in a panel of 22 murine microRNAs selected for qPCR validation [PMC3319598]. In another study, the downregulation of mmu-mir-200b and mmu-mir-200c after high-fat diet-induced obesity was found to be consistent with their role in promoting adipogenesis [PMC3319598]. Mmu-mir-200c is also involved in normal external ear development in mammals and may have implications for microtia etiology [PMC4932619]. The expression and function of mmu-mir-200c have been investigated using various techniques such as dilution with siPORT, qPCR validation, and construction of vectors containing its loci [PMC3789096][PMC3319598][PMC6889074].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGCCGGGUAAUGAUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Bos taurus bta-miR-200c
  2. Callithrix jacchus cja-miR-200c
  3. Canis lupus familiaris (dog) cfa-miR-200c
  4. Capra hircus (goat) chi-miR-200c
  5. Cavia porcellus cpo-miR-200c-3p
  6. Cervus elaphus (red deer) cel-miR-200c
  7. Cricetulus griseus cgr-miR-200c
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-8-P1b_3p (mature (guide))
  9. Eptesicus fuscus efu-miR-200c
  10. Equus caballus (horse) eca-miR-200c
  11. Gallus gallus Gallus_gallus piRNA piR-gga-384324
  12. Homo sapiens (human) hsa-miR-200c-3p
  13. Macaca mulatta Mml-Mir-8-P1b_3p (mature (guide))
  14. Monodelphis domestica Mdo-Mir-8-P1b_3p (mature (guide))
  15. Oryctolagus cuniculus ocu-miR-200c-3p
  16. Pan troglodytes (chimpanzee) ptr-miR-200c
  17. Pteropus alecto pal-miR-200c-3p
  18. Rattus norvegicus (Norway rat) Rno-Mir-8-P1b_3p (mature (guide))
  19. Tupaia chinensis (Chinese tree shrew) tch-miR-200c-3p
Publications