Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Eptesicus fuscus (big brown bat) efu-miR-200c URS0000192F9C_29078

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGCCGGGUAAUGAUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Bos taurus bta-miR-200c
  2. Callithrix jacchus cja-miR-200c
  3. Canis lupus familiaris (dog) cfa-miR-200c
  4. Capra hircus (goat) chi-miR-200c
  5. Cavia porcellus cpo-miR-200c-3p
  6. Cervus elaphus (red deer) cel-miR-200c
  7. Cricetulus griseus cgr-miR-200c
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-8-P1b_3p (mature (guide))
  9. Equus caballus (horse) eca-miR-200c
  10. Gallus gallus Gallus_gallus piRNA piR-gga-384324
  11. Homo sapiens (human) hsa-miR-200c-3p
  12. Macaca mulatta Mml-Mir-8-P1b_3p (mature (guide))
  13. Monodelphis domestica Mdo-Mir-8-P1b_3p (mature (guide))
  14. Mus musculus (house mouse) mmu-miR-200c-3p
  15. Oryctolagus cuniculus ocu-miR-200c-3p
  16. Pan troglodytes (chimpanzee) ptr-miR-200c
  17. Pteropus alecto pal-miR-200c-3p
  18. Rattus norvegicus (Norway rat) Rno-Mir-8-P1b_3p (mature (guide))
  19. Tupaia chinensis (Chinese tree shrew) tch-miR-200c-3p
Publications