Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-200c URS0000192F9C_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-200c: Cfa-mir-200c is a microRNA that is part of the miR-200 family and is transcribed from chromosome 27 [PMC4049822]. In a study on the epididymis of dogs, it was found that the expression of cfa-mir-200c was increased in dogs older than 3 years of age [PMC10135127]. Along with cfa-mir-200c, other miRNAs such as cfa-miR-26a and members of the cfa-let-7 family were also found to have increased expression in older dogs [PMC10135127]. These miRNAs, including cfa-mir-200c, were shown to be involved in aging in dogs through their regulation via PTEN [PMC10135127]. In another study on spermatogenesis, it was found that exogenous administration of retinoic acid (RA) and a CYP26B1 inhibitor up-regulated the expressions of cfa-miR-200a, cfa-miR-200b, cfa-mir-200c, and cfa-miR-141 [PMC4049822]. These miRNAs were part of miRNA families such as miR-200 and Mirlet-7 that were significantly up-regulated with testicular RA intervention [PMC4049822]. Additionally, other miRNAs such as cfa-miR18a, cfa-miR20b, and cfa-miR21 were also identified in this study [PMC9032658]. Overall, these findings highlight the involvement of cfa-mir-200c in aging and spermatogenesis processes in dogs.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGCCGGGUAAUGAUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Bos taurus bta-miR-200c
  2. Callithrix jacchus cja-miR-200c
  3. Capra hircus (goat) chi-miR-200c
  4. Cavia porcellus cpo-miR-200c-3p
  5. Cervus elaphus (red deer) cel-miR-200c
  6. Cricetulus griseus cgr-miR-200c
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-8-P1b_3p (mature (guide))
  8. Eptesicus fuscus efu-miR-200c
  9. Equus caballus (horse) eca-miR-200c
  10. Gallus gallus Gallus_gallus piRNA piR-gga-384324
  11. Homo sapiens (human) hsa-miR-200c-3p
  12. Macaca mulatta Mml-Mir-8-P1b_3p (mature (guide))
  13. Monodelphis domestica Mdo-Mir-8-P1b_3p (mature (guide))
  14. Mus musculus (house mouse) mmu-miR-200c-3p
  15. Oryctolagus cuniculus ocu-miR-200c-3p
  16. Pan troglodytes (chimpanzee) ptr-miR-200c
  17. Pteropus alecto pal-miR-200c-3p
  18. Rattus norvegicus (Norway rat) Rno-Mir-8-P1b_3p (mature (guide))
  19. Tupaia chinensis (Chinese tree shrew) tch-miR-200c-3p
Publications