Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (domestic cattle) bta-miR-200c URS0000192F9C_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-200c: Bta-mir-200c is a microRNA (miRNA) that plays a significant role in the immune system of cattle, as it is one of the fifteen miRNAs that account for approximately 80% of the immune-related miRNAs [PMC6940744]. It is involved in discriminating between pregnant and cyclic animals, as indicated by its inclusion in a set of miRNAs used for principal component analysis (PCA) [PMC5325256]. Bta-mir-200c, along with other members of the miR-200 family, was found to be significantly upregulated in unmated musk glands compared to mated ones [PMC8710055]. It targets pathways related to antigen processing and presentation as well as allograft rejection [PMC5617439], and it is predicted to mediate cellular metabolic processes [PMC5617439]. The expression levels of bta-mir-200c increase following IFN-τ treatment [PMC5617439], and it shows consistent upregulation in CE endometrial samples, indicating its role in reproductive processes [PMC4617749]. Additionally, bta-mir-200c has been identified as related to lipid metabolism and was upregulated in the liver tissue (LD) of steers [PMC8993808], suggesting its involvement in metabolic regulation. It has also been identified as differentially expressed (DE) in bovine mammary epithelial cells stimulated with S. uberis, indicating its potential role in response to infection or inflammation [PMC4065264].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGCCGGGUAAUGAUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

Relationships

Molecular Relationships

Publications