Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-200c URS0000192F9C_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-200c: Bta-mir-200c is an immune-related miRNA that is part of the miRNA family miR-200c [PMC6940744]. It is one of the top 15 miRNAs that account for about 80% of the total miRNAs [PMC6940744]. Bta-mir-200c has been used in studies to discriminate between pregnant and cyclic animals using PCA analysis [PMC5325256]. It has also been found to be up-regulated in unmated musk glands compared to mated musk glands [PMC8710055]. Bta-mir-200c has been shown to target pathways related to antigen processing and presentation, allograft rejection, and cellular metabolic processes [PMC5617439]. In studies involving IFN-τ treatment, the expression of bta-mir-200c was found to be increased [PMC5617439]. It has also been found to be up-regulated in CE endometrial samples [PMC4617749]. Bta-mir-200c is one of the potential miRNAs related to lipid metabolism that have been identified in studies [PMC8993808]. In studies involving bovine mammary epithelial cells stimulated with S. uberis, bta-mir-200c was identified as a differentially expressed miRNA [PMC4065264]. Additionally, bta-mir-200c was found exclusively in UF samples compared to OF samples [PMC9594899]. References: [PMC6940744] [PMC5325256] [PMC8710055] [PMC5617439] [PMC4617749] [PM8993808] [PM4065264] [PM9594899]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGCCGGGUAAUGAUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Callithrix jacchus cja-miR-200c
  2. Canis lupus familiaris (dog) cfa-miR-200c
  3. Capra hircus (goat) chi-miR-200c
  4. Cavia porcellus cpo-miR-200c-3p
  5. Cervus elaphus (red deer) cel-miR-200c
  6. Cricetulus griseus cgr-miR-200c
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-8-P1b_3p (mature (guide))
  8. Eptesicus fuscus efu-miR-200c
  9. Equus caballus (horse) eca-miR-200c
  10. Gallus gallus Gallus_gallus piRNA piR-gga-384324
  11. Homo sapiens (human) hsa-miR-200c-3p
  12. Macaca mulatta Mml-Mir-8-P1b_3p (mature (guide))
  13. Monodelphis domestica Mdo-Mir-8-P1b_3p (mature (guide))
  14. Mus musculus (house mouse) mmu-miR-200c-3p
  15. Oryctolagus cuniculus ocu-miR-200c-3p
  16. Pan troglodytes (chimpanzee) ptr-miR-200c
  17. Pteropus alecto pal-miR-200c-3p
  18. Rattus norvegicus (Norway rat) Rno-Mir-8-P1b_3p (mature (guide))
  19. Tupaia chinensis (Chinese tree shrew) tch-miR-200c-3p
Publications