Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cricetulus griseus (Chinese hamster) cgr-miR-200c URS0000192F9C_10029

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGCCGGGUAAUGAUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Bos taurus bta-miR-200c
  2. Callithrix jacchus cja-miR-200c
  3. Canis lupus familiaris cfa-miR-200c
  4. Capra hircus chi-miR-200c
  5. Cavia porcellus (domestic guinea pig) cpo-miR-200c-3p
  6. Cervus elaphus cel-miR-200c
  7. Echinops telfairi Ete-Mir-8-P1b_3p (mature (guide))
  8. Eptesicus fuscus efu-miR-200c
  9. Equus caballus eca-miR-200c
  10. Gallus gallus Gallus_gallus piRNA piR-gga-384324
  11. Homo sapiens (human) hsa-miR-200c-3p
  12. Macaca mulatta Mml-Mir-8-P1b_3p (mature (guide))
  13. Monodelphis domestica Mdo-Mir-8-P1b_3p (mature (guide))
  14. Mus musculus mmu-miR-200c-3p
  15. Oryctolagus cuniculus (rabbit) ocu-miR-200c-3p
  16. Pan troglodytes (chimpanzee) ptr-miR-200c
  17. Pteropus alecto pal-miR-200c-3p
  18. Rattus norvegicus Rno-Mir-8-P1b_3p (mature (guide))
  19. Tupaia chinensis (Chinese tree shrew) tch-miR-200c-3p
Publications