Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-375-3p URS00000ED600_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-375: Mmu-mir-375 is a microRNA that has been studied in various contexts. It has been reported that Tan IIA downregulates mmu-mir-375 to increase the KLF4 protein expression and ameliorate atherosclerosis in ApoE knockout mice [PMC9273410]. Mmu-mir-375 does not affect the secondary signals or the actin filament network [PMC1790902]. It is suspected to play a role in exocytosis processes [PMC1790902]. Mtpn has been validated as a target gene of mmu-mir-375 [PMC1790902]. The expression of mmu-mir-375 is limited to pancreatic β cells, but it has also been detected in the rat lung [PMC1790902]. Mmu-mir-375 is highly expressed in the lung and has an identical mature sequence between human and mouse, but it targets different genes between the two species [PMC5372489]. It is upregulated in prostate cancer and hepatocellular carcinoma, but decreased in squamous cell carcinoma [PMC8287301]. In mouse OIR retinas, mmu-mir-375 showed significant down-regulation [PMC5032015]. Mmu-miR-7-5p and mmu-miR-26a-5p are more abundant than mmu-mir-375 in MIN6 cells, while the opposite is observed in murine acini cells [PMC10037588]. The targets of mmu-mir-375 are limited according to available databases, with only 20 experimentally confirmed targets expressed in heart tissue [PMC7765785]. Mmu-miR-141, mmu-miR298, and mmu-miR 346 levels are altered with disease progression and released into serum samples. In MIN6 cells, transfection with different mimics or inhibitors of mmu-mir-375 and mmu-miR-29 showed varying effects [PMC3767796]. These findings highlight the diverse roles and expression patterns of mmu-mir-375 in different biological contexts.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGUUCGUUCGGCUCGCGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus (cattle) Bta-Mir-375_3p (mature (guide))
  2. Canis lupus familiaris (dog) cfa-miR-375
  3. Cavia porcellus cpo-miR-375-3p
  4. Cervus elaphus (red deer) Cel-miR-375
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-375-3p
  6. Echinops telfairi Ete-Mir-375_3p (mature (guide))
  7. Gorilla gorilla gorilla ggo-miR-375 (MIR375)
  8. Gorilla gorilla ggo-miR-375
  9. Homo sapiens (human) hsa-miR-375-3p
  10. Macaca mulatta mml-miR-375
  11. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-375_3p (mature (guide))
  12. Ornithorhynchus anatinus (platypus) Oan-Mir-375_3p (mature (guide))
  13. Oryctolagus cuniculus (rabbit) ocu-miR-375-3p
  14. Pan troglodytes ptr-miR-375
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-375
  16. Pteropus alecto pal-miR-375-3p
  17. Ptychodera flava Pfl-Mir-375_3p (mature (guide))
  18. Rattus norvegicus (Norway rat) rno-miR-375-3p
  19. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-375_3p (mature (guide))
  20. Sus scrofa (pig) ssc-miR-375
Publications