Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-499 URS00000C7662_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-499: Inhibition of bta-mir-499 leads to deregulation of the inflammatory response at the maternal-fetal interface and fetal growth retardation [PMC9334902]. Bta-mir-499, derived from placental exosomes, regulates inflammation locally at the maternal-fetal annex through the inhibition of NK-kB signaling [PMC9334902]. Inhibition of bta-mir-499 results in inflammatory deregulation at the maternal–fetal interface, placental loss, and fetal growth restriction [PMC7432060]. Bta-mir-499 contributes to the regulation of local inflammation at the maternal–fetal interface by inhibiting NF-κB signaling [PMC7432060]. Placental exosome-derived bta-mir-499 inhibits LPS-induced inflammation in cultured bovine endometrial epithelial cells and is associated with bovine pregnancy loss in vivo [PMC10036776]. Bta-mir-499 inhibits NF-κB activation via Lin288/let-7 axis, attenuating inflammatory responses in cattle [PMC7991791]. Placental-derived exosomal bta-mir-499 inhibits NF-kB activation by targeting Lin28B/let7 axis at the maternal-fetal interface in early gestation [PMC10034510]. Bta-mir-499 is significantly enriched in early pregnancy exosomes and decreases LPS-induced expression of proinflammatory cytokines by inhibiting NF-kB signaling [PMC5999645]. Exosome-derived bta-miR-499 regulates Lin28B expression, leading to downregulation of proinflammatory cytokine expression through inhibition of NF-kB activation [PMC5999645]. Exosome-derived bta-miR-499 attenuates proinflammatory cytokine expression by negatively regulating NF-kB p65 activation through a loop involving Lin28B and bta-Let7 miRNAs [PMC5999645]. Placental exosome-derived bta-mir-499 is involved in the regulation of uterine inflammation during early pregnancy [PMC5999645]. Bta-mir-499 expression is increased in tissue exposed to S. aureus in bovine responses [PMC7937231].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAGACUUGCAGUGAUGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Alligator mississippiensis (American alligator) ami-miR-499-5p
  2. Callithrix jacchus cja-miR-499a
  3. Canis lupus familiaris cfa-miR-499
  4. Capra hircus chi-miR-499-5p
  5. Equus caballus eca-miR-499-5p
  6. Homo sapiens hsa-miR-499a-5p
  7. Ictalurus punctatus ipu-miR-499
  8. Macaca mulatta (Rhesus monkey) mml-miR-499-5p
  9. Monodelphis domestica mdo-miR-499-5p
  10. Mus musculus mmu-miR-499-5p
  11. Pongo pygmaeus ppy-miR-499-5p
  12. Pteropus alecto (black flying fox) pal-miR-499a-5p
  13. Rattus norvegicus (Norway rat) rno-miR-499-5p
  14. Sus scrofa ssc-miR-499-5p
  15. Tupaia chinensis tch-miR-499a-5p
  16. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1658060
Publications