v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1658060 URS00000C7662_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUAAGACUUGCAGUGAUGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Alligator mississippiensis (American alligator) ami-miR-499-5p
  2. Bos taurus bta-miR-499
  3. Callithrix jacchus cja-miR-499a
  4. Canis lupus familiaris cfa-miR-499
  5. Capra hircus chi-miR-499-5p
  6. Equus caballus eca-miR-499-5p
  7. Homo sapiens hsa-miR-499a-5p
  8. Ictalurus punctatus ipu-miR-499
  9. Macaca mulatta (Rhesus monkey) mml-miR-499-5p
  10. Monodelphis domestica mdo-miR-499-5p
  11. Mus musculus mmu-miR-499-5p
  12. Pongo pygmaeus ppy-miR-499-5p
  13. Pteropus alecto (black flying fox) pal-miR-499a-5p
  14. Rattus norvegicus (Norway rat) rno-miR-499-5p
  15. Sus scrofa ssc-miR-499-5p
  16. Tupaia chinensis tch-miR-499a-5p