Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-499-5p URS00000C7662_13616

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAGACUUGCAGUGAUGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Alligator mississippiensis ami-miR-499-5p
  2. Bos taurus bta-miR-499
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-499a
  4. Canis lupus familiaris cfa-miR-499
  5. Capra hircus (goat) chi-miR-499-5p
  6. Equus caballus eca-miR-499-5p
  7. Homo sapiens (human) hsa-miR-499a-5p
  8. Ictalurus punctatus (channel catfish) ipu-miR-499
  9. Macaca mulatta (Rhesus monkey) mml-miR-499-5p
  10. Mus musculus (house mouse) mmu-miR-499-5p
  11. Pongo pygmaeus ppy-miR-499-5p
  12. Pteropus alecto pal-miR-499a-5p
  13. Rattus norvegicus (Norway rat) rno-miR-499-5p
  14. Sus scrofa ssc-miR-499-5p
  15. Tupaia chinensis (Chinese tree shrew) tch-miR-499a-5p
  16. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1658060
Publications