Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-499a-5p URS00000C7662_9606

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAGACUUGCAGUGAUGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Alligator mississippiensis (American alligator) ami-miR-499-5p
  2. Bos taurus bta-miR-499
  3. Callithrix jacchus cja-miR-499a
  4. Canis lupus familiaris cfa-miR-499
  5. Capra hircus chi-miR-499-5p
  6. Equus caballus eca-miR-499-5p
  7. Ictalurus punctatus ipu-miR-499
  8. Macaca mulatta (Rhesus monkey) mml-miR-499-5p
  9. Monodelphis domestica mdo-miR-499-5p
  10. Mus musculus mmu-miR-499-5p
  11. Pongo pygmaeus ppy-miR-499-5p
  12. Pteropus alecto (black flying fox) pal-miR-499a-5p
  13. Rattus norvegicus (Norway rat) rno-miR-499-5p
  14. Sus scrofa ssc-miR-499-5p
  15. Tupaia chinensis tch-miR-499a-5p
  16. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1658060
Publications