Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-326 URS00000A939F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-326: Hsa-mir-326 is a microRNA that has been identified as differentially expressed in chronic myeloid leukemia (CML) patients, showing a down-regulation in resistant cases as compared to responders [PMC2743636]. This microRNA has been associated with significant biological effects in non-small cell lung cancer (NSCLC) animal models, where its overexpression led to reduced tumor growth and metastasis, as well as decreased PD-L1 expression [PMC9659572]. Furthermore, hsa-mir-326 overexpression has been linked to an increased infiltration of CD8+ cells and a higher population of TNF-α+ IFN-γ+ CD8+ T-cells within tumor tissues [PMC9659572]. In the context of CML, patients who responded to treatment exhibited significantly higher levels of hsa-mir-326 compared to those who did not respond [PMC7794682]. This suggests that hsa-mir-326 may play a role in the response to treatment in CML and could potentially serve as a biomarker for treatment efficacy or as a therapeutic target.

mRNA interactions 45 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCUGGGCCCUUCCUCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

Relationships

Molecular Relationships

Publications