Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) Mml-Mir-326_3p (mature (guide)) URS00000A939F_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCUGGGCCCUUCCUCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus bta-miR-326
  2. Canis lupus familiaris cfa-miR-326
  3. Cavia porcellus cpo-miR-326-3p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-326-3p
  5. Echinops telfairi Ete-Mir-326_3p (mature (guide))
  6. Gorilla gorilla gorilla ggo-miR-326 (MIR326)
  7. Gorilla gorilla ggo-miR-326
  8. Homo sapiens hsa-miR-326
  9. Macaca fascicularis microRNA miR-326-3p
  10. Mus musculus Mmu-Mir-326_3p (mature (guide))
  11. Oryctolagus cuniculus ocu-miR-326-3p
  12. Pan troglodytes (chimpanzee) ptr-miR-326
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-326
  14. Rattus norvegicus Rno-Mir-326_3p (mature (guide))
  15. Sus scrofa ssc-miR-326