Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-326 URS00000A939F_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-326: ssc-mir-326 is a microRNA (miRNA) identified in pigs that is differentially expressed in liver tissue under normoxic and hypoxic conditions and is associated with pathways relevant to cancer and focal adhesion [PMC8861501]. This miRNA, particularly the rs319154814 (G/A) polymorphism within its apical loop, has been linked to the expression levels of its target mRNAs, with significant associations found after multiple testing corrections [PMC8097994]. Notably, pigs homozygous for the A-allele of this polymorphism exhibited an approximate 1.9-fold increase in ssc-mir-326 expression, although this increase was not statistically significant [PMC8097994]. The ssc-mir-326 genotype also correlates with the expression of circadian clock regulatory genes such as HDAC3 and PER1 [PMC8097994]. Furthermore, this miRNA polymorphism has been associated with lipid traits in pigs [PMC8097994]. The hepatic mRNA targets most significantly associated with the ssc-mir-326 genotype include CFLAR, PPP1CC, SDC1, SF3A3, and FSTL1 [PMC8097994], suggesting a potential role for ssc-mir-326 in lipid metabolism pathways despite no direct effects on myristic fatty acid metabolism being described to date [PMC8097994]. The rs319154814 (G/A) variant may enhance the repressive activity of ssc-mir-326 on its mRNA targets such as PPP1CC [PMC8097994], indicating a functional impact of this polymorphism on gene regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCUGGGCCCUUCCUCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

Relationships

Molecular Relationships

Publications