Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (domestic cattle) bta-miR-326 URS00000A939F_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-326: Bta-mir-326 is a downregulated microRNA (miRNA) in bovine species that exhibits high betweenness centrality in a network analysis, indicating its potential role as a key regulator in the network of downregulated miRNAs when comparing day 28 and 63 postpartum [PMC9445238]. This miRNA is implicated in the regulation of spermatogenesis, as evidenced by its targeting of the prolactin receptor (PRLR) gene, which significantly affects the proliferation of rat Sertoli cells [PMC9940382]. Bta-mir-326 is also involved in yak testis development and spermatogenesis through its targeting of multiple members of the TGF-β signaling pathway, including BMP2, TGFB2, SMAD6, GDF6, and TGFBR2 [PMC9940382]. It is associated with the Wnt signaling pathway, but the specific number of genes it targets within this pathway is not detailed [PMC9940382]. Additionally, bta-mir-326 is identified as one of the most multifunctional miRNAs influencing genes within the GnRH signaling pathway [PMC9940382], and it plays a role in controlling target genes across multiple pathways such as TGF–β, GnRH, PI3K–Akt, MAPK, Wnt, and AMPK pathways [PMC9940382], highlighting its broad regulatory potential across various biological processes related to reproductive development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCUGGGCCCUUCCUCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

Relationships

Molecular Relationships

Publications