Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-326 URS00000A939F_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-326: Bta-mir-326 is a downregulated miRNA that shows high betweenness in a network analysis [PMC9445238]. It is also associated with the target gene PRLR, which plays a role in spermatogenesis [PMC9940382]. In a study on yak testis development and spermatogenesis, bta-mir-326 was found to be enriched in the TGF-β and Wnt signaling pathways, targeting genes such as BMP2, TGFB2, SMAD6, GDF6, TGFBR2, and genes in the Wnt signaling pathway [PMC9940382]. Bta-mir-326 was also identified as one of the most multifunctional miRNAs controlling target genes in the GnRH signaling pathway [PMC9940382]. Additionally, bta-mir-326 was found to be one of the most functional miRNAs controlling target genes in pathways such as TGF–β, GnRH, PI3K–Akt, MAPK, Wnt and AMPK [PMC9940382]. Overall, bta-mir-326 is a downregulated miRNA that plays a role in spermatogenesis and is involved in various signaling pathways related to testis development. It shows high betweenness and has regulatory effects on target genes involved in these pathways.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCUGGGCCCUUCCUCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Canis lupus familiaris cfa-miR-326
  2. Cavia porcellus cpo-miR-326-3p
  3. Dasypus novemcinctus (nine-banded armadillo) dno-miR-326-3p
  4. Echinops telfairi Ete-Mir-326_3p (mature (guide))
  5. Gorilla gorilla gorilla ggo-miR-326 (MIR326)
  6. Gorilla gorilla ggo-miR-326
  7. Homo sapiens hsa-miR-326
  8. Macaca fascicularis microRNA miR-326-3p
  9. Macaca mulatta Mml-Mir-326_3p (mature (guide))
  10. Mus musculus Mmu-Mir-326_3p (mature (guide))
  11. Oryctolagus cuniculus ocu-miR-326-3p
  12. Pan troglodytes (chimpanzee) ptr-miR-326
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-326
  14. Rattus norvegicus Rno-Mir-326_3p (mature (guide))
  15. Sus scrofa ssc-miR-326
Publications