Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-22-3p URS0000096022_9031

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, RefSeq, miRBase, MirGeneDB). Gallus gallus (chicken) gga-miR-22-3p sequence is a product of MIR22, gga-miR-22-3p, MIR-22, miR-22-3p, gga-miR-22, miR-22 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAGCUGCCAGUUGAAGAACUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 50 other species

    1. Alligator mississippiensis Ami-Mir-22-P1b_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-22-P1b_3p (mature (guide))
    3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-22
    4. Ateles geoffroyi age-miR-22
    5. Bos taurus Bta-Mir-22-P1b_3p (mature (guide))
    6. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-22
    7. Callorhinchus milii Cmi-Mir-22-P1b_3p (mature (guide))
    8. Canis lupus familiaris (dog) cfa-miR-22
    9. Cavia porcellus cpo-miR-22-3p
    10. Cervus elaphus cel-miR-22-3p
    11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-22-P1b_3p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-miR-22-3p
    13. Columba livia cli-miR-22-3p
    14. Cricetulus griseus cgr-miR-22-3p
    15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-22-3p
    16. Daubentonia madagascariensis (aye-aye) dma-miR-22
    17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-22-P1b_3p (mature (guide))
    18. Equus caballus eca-miR-22
    19. Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide))
    20. Homo sapiens (human) hsa-miR-22-3p
    21. Lagothrix lagotricha lla-miR-22
    22. Latimeria chalumnae Lch-Mir-22-P1b_3p (mature (guide))
    23. Lemur catta lca-miR-22
    24. Lepisosteus oculatus Loc-Mir-22-P1b_3p (mature (guide))
    25. Macaca mulatta mml-miR-22
    26. Macaca nemestrina (pig-tailed macaque) mne-miR-22
    27. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
    28. Microcebus murinus mmr-miR-22
    29. Mus musculus (house mouse) mmu-miR-22-3p
    30. Nomascus leucogenys nle-miR-22
    31. Ophiophagus hannah (king cobra) oha-miR-22a
    32. Ornithorhynchus anatinus oan-miR-22-3p
    33. Oryctolagus cuniculus (rabbit) ocu-miR-22-3p
    34. Otolemur garnettii (small-eared galago) oga-miR-22
    35. Pan paniscus (pygmy chimpanzee) ppa-miR-22
    36. Pan troglodytes (chimpanzee) ptr-miR-22
    37. Papio hamadryas (hamadryas baboon) pha-miR-22
    38. Pongo pygmaeus ppy-miR-22
    39. Pteropus alecto pal-miR-22-3p
    40. Python bivittatus pbv-miR-22-3p
    41. Rattus norvegicus rno-miR-22-3p
    42. Saguinus labiatus sla-miR-22
    43. Saimiri boliviensis boliviensis sbo-miR-22
    44. Scyliorhinus torazame (cloudy catshark) Sto-Mir-22-P1b_3p (mature (guide))
    45. Sphenodon punctatus (tuatara) Spt-Mir-22-P1b_3p (mature (guide))
    46. Sus scrofa (pig) ssc-miR-22-3p
    47. Taeniopygia guttata Tgu-Mir-22-P1b_3p (mature (guide))
    48. Tupaia chinensis tch-miR-22-3p
    49. Xenopus laevis Xla-Mir-22-P1b4_3p (mature (co-guide))
    50. Xenopus tropicalis (tropical clawed frog) xtr-miR-22-3p
    Publications New