Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-125a URS000008E301_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-125a: Ssc-mir-125a is a microRNA that is associated with inhibiting proliferation and targets more than 14 genes [PMC5796217]. It is a member of the miR-10 family, along with ssc-miR-10, ssc-miR-10a-5p, and ssc-miR-125b, which all target the hub genes WHSC1 and MKI67 [PMC5796217]. Ssc-mir-125a is differentially expressed after Salmonella challenge in peripheral blood [PMC6560770]. It is also one of the microRNA candidates that are differentially expressed after Salmonella challenge in peripheral blood and have over-represented binding sites in differentially expressed mRNA list [PMC6560770]. Ssc-mir-125a potentially targets IL13 with a slight decrease in expression at 25 dpi [PMC8851844]. It is also downregulated in expression at 50 dpi along with other miRNAs in subclusters SOM1 and SOM25 [PMC8851844]. Ssc-mir-125a shows variable expression patterns compared to other miRNAs [PMC3555835]. It is highly expressed in the anterior pituitary along with other miRNAs such as ssc-miR-125b and ssc-miR-23b [PMC4489742]. In the context of cardiac ischemia/reperfusion injury, the expression of endogenous ssc-mir-125a decreases, but intramyocardial injection of miR-125a agomir elevates its levels [PMC9830430]. Ssc-mir-125a may promote apoptosis of granulosa cells by binding to NOVEL_00001850 and down-regulating the CYP19A1 gene [PMC7962063]. Additionally, it has been found to repress the differentiation of porcine preadipocytes [PMC4493643].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGAGACCCUUUAACCUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus bta-miR-125a
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-125a
  3. Capra hircus (goat) miR-125a#@
  4. Daubentonia madagascariensis (aye-aye) dma-miR-125a
  5. Gallus gallus Gallus_gallus piRNA piR-gga-29668
  6. Mus musculus Mus_musculus piRNA piR-mmu-72521
  7. Ovis aries (sheep) miscellaneous RNA
  8. Pan paniscus ppa-miR-125a
  9. Papio hamadryas (hamadryas baboon) pha-miR-125a
  10. Tupaia chinensis tch-miR-125a-5p
Publications