Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72521 URS000008E301_10090

• 23 nucleotides
• 2 databases (ENA, PirBase)
• Found in 10 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. piRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UCCCUGAGACCCUUUAACCUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

1. Bos taurus bta-miR-125a
2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-125a
3. Capra hircus (goat) miR-125a#@
4. Daubentonia madagascariensis (aye-aye) dma-miR-125a
5. Gallus gallus Gallus_gallus piRNA piR-gga-29668
6. Ovis aries (sheep) miscellaneous RNA
7. Pan paniscus ppa-miR-125a
8. Papio hamadryas (hamadryas baboon) pha-miR-125a
9. Sus scrofa (pig) ssc-miR-125a
10. Tupaia chinensis tch-miR-125a-5p

Download

• FASTA
• JSON