Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) ppa-miR-125a URS000008E301_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGAGACCCUUUAACCUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus bta-miR-125a
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-125a
  3. Capra hircus (goat) miR-125a#@
  4. Daubentonia madagascariensis (aye-aye) dma-miR-125a
  5. Gallus gallus Gallus_gallus piRNA piR-gga-29668
  6. Mus musculus Mus_musculus piRNA piR-mmu-72521
  7. Ovis aries (sheep) miscellaneous RNA
  8. Papio hamadryas (hamadryas baboon) pha-miR-125a
  9. Sus scrofa (pig) ssc-miR-125a
  10. Tupaia chinensis tch-miR-125a-5p
Publications