Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-125a URS000008E301_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-125a: Bta-mir-125a is a miRNA that has been identified as having significant regulatory immune functions. It has been found to be correlated with the expression of genes WDPCP, VMAC, and ITGA10 [PMC7242321]. Bta-mir-125a is one of the most abundant miRNAs found in commercial milk and is known to have immunological roles that are not affected by pasteurization, homogenization, or heat treatment [PMC10094152]. It has also been identified as a hub miRNA in the regulation of genes such as PIK3CB, VEGFA, MAPK14, PIK3R1, and CASP3 [PMC5831392]. The levels of bta-mir-125a have been found to vary during pre-implantation embryo development [PMC5662615]. Bta-mir-125a is one of the 13 immune-related miRNAs that are among the top 20 most abundant miRNAs in bovine samples [PMC7070426]. It has also been found to be a member of the eumetazoan mir-10 family and has three orthologs in cattle [PMC5390025]. Bta-mir-125a has similarities with human miRNA hsa-miR-99b/let-7e/miR-125a cluster and plays a role in stabilizing the suppressive phenotype of antigen presenting cells [PMC6950176]. Additionally, bta-mir-125a has been found to be differentially expressed during early pregnancy in cattle [PMC6418173]. It is regulated in both MC and SM fractions [PMC5325256] and also has orthologs in F. hepatica [PMC8036276]. Overall, bta-mir-125a is an abundant immune-related miRNA with significant regulatory functions in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGAGACCCUUUAACCUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-125a
  2. Capra hircus (goat) miR-125a#@
  3. Daubentonia madagascariensis (aye-aye) dma-miR-125a
  4. Gallus gallus Gallus_gallus piRNA piR-gga-29668
  5. Mus musculus Mus_musculus piRNA piR-mmu-72521
  6. Ovis aries (sheep) miscellaneous RNA
  7. Pan paniscus ppa-miR-125a
  8. Papio hamadryas (hamadryas baboon) pha-miR-125a
  9. Sus scrofa (pig) ssc-miR-125a
  10. Tupaia chinensis tch-miR-125a-5p
Publications