v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) miscellaneous RNA URS000008E301_9940

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCCUGAGACCCUUUAACCUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus bta-miR-125a
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-125a
  3. Capra hircus (goat) miR-125a#@
  4. Daubentonia madagascariensis (aye-aye) dma-miR-125a
  5. Gallus gallus Gallus_gallus piRNA piR-gga-29668
  6. Mus musculus Mus_musculus piRNA piR-mmu-72521
  7. Pan paniscus ppa-miR-125a
  8. Papio hamadryas (hamadryas baboon) pha-miR-125a
  9. Sus scrofa (pig) ssc-miR-125a
  10. Tupaia chinensis tch-miR-125a-5p