v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-30a-3p URS0000065D58_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUUUCAGUCGGAUGUUUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis ami-miR-30a-3p
  2. Anolis carolinensis aca-miR-30a-3p
  3. Cavia porcellus (domestic guinea pig) cpo-miR-30a-3p
  4. Chrysemys picta cpi-miR-30a-3p
  5. Columba livia (rock pigeon) cli-miR-30e-3p
  6. Cricetulus griseus (Chinese hamster) cgr-miR-30a-3p
  7. Danio rerio (zebrafish) dre-miR-30e-3p
  8. Dasypus novemcinctus dno-miR-30a-3p
  9. Gallus gallus gga-miR-30a-3p
  10. Gorilla gorilla gorilla ggo-miR-30a-3p (MIR30A)
  11. Gorilla gorilla ggo-miR-30a-3p
  12. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30a-3p
  13. Homo sapiens (human) hsa-miR-30a-3p
  14. Ictalurus punctatus (channel catfish) ipu-miR-30e
  15. Macaca mulatta (Rhesus monkey) mml-miR-30a-3p
  16. Mus musculus mmu-miR-30a-3p
  17. Ophiophagus hannah (king cobra) oha-miR-30a-3p
  18. Ornithorhynchus anatinus oan-miR-30a-3p
  19. Pan paniscus ppa-miR-30a-3p
  20. Pan troglodytes ptr-miR-30a-3p
  21. Pongo pygmaeus ppy-miR-30a-3p
  22. Python bivittatus pbv-miR-30a-3p
  23. Rattus norvegicus (Norway rat) rno-miR-30a-3p
  24. Salmo salar (Atlantic salmon) ssa-miR-30d-3p
  25. Sus scrofa ssc-miR-30a-3p
  26. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-30-P1b_3p (mature (guide))
  27. Tor tambroides miR-30e-3p
  28. Tursiops truncatus miR-30a-3p
 Publications